Incidental Mutation 'R6644:Ube2d1'
ID 526016
Institutional Source Beutler Lab
Gene Symbol Ube2d1
Ensembl Gene ENSMUSG00000019927
Gene Name ubiquitin-conjugating enzyme E2D 1
Synonyms UBCH5
MMRRC Submission 044765-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6644 (G1)
Quality Score 200.009
Status Validated
Chromosome 10
Chromosomal Location 71090810-71121092 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 71092530 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 105 (S105P)
Ref Sequence ENSEMBL: ENSMUSP00000020085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020085]
AlphaFold P61080
Predicted Effect possibly damaging
Transcript: ENSMUST00000020085
AA Change: S105P

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000020085
Gene: ENSMUSG00000019927
AA Change: S105P

DomainStartEndE-ValueType
UBCc 4 147 3.67e-76 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144231
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144636
Meta Mutation Damage Score 0.7880 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.3%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is closely related to a stimulator of iron transport (SFT), and is up-regulated in hereditary hemochromatosis. It also functions in the ubiquitination of the tumor-suppressor protein p53 and the hypoxia-inducible transcription factor HIF1alpha by interacting with the E1 ubiquitin-activating enzyme and the E3 ubiquitin-protein ligases. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 C T 10: 79,844,598 (GRCm39) P1461L probably damaging Het
Abhd14a T C 9: 106,321,472 (GRCm39) Y10C probably damaging Het
Adcy2 C T 13: 68,816,671 (GRCm39) V772M possibly damaging Het
Apob A G 12: 8,059,077 (GRCm39) M2487V probably damaging Het
B4galnt1 T C 10: 127,007,662 (GRCm39) probably null Het
Cabp7 C T 11: 4,690,396 (GRCm39) V76I probably benign Het
Cbr3 A G 16: 93,487,399 (GRCm39) Y194C probably damaging Het
Cdk18 G A 1: 132,049,807 (GRCm39) Q58* probably null Het
Cryba4 T C 5: 112,394,628 (GRCm39) D167G probably damaging Het
Czib T G 4: 107,752,119 (GRCm39) I130S probably damaging Het
Dner T C 1: 84,373,428 (GRCm39) N588S probably damaging Het
Dnm1l T C 16: 16,147,737 (GRCm39) I343V probably benign Het
Eif1ad16 A G 12: 87,985,460 (GRCm39) F28L probably benign Het
Fam168b C A 1: 34,875,822 (GRCm39) G21V probably damaging Het
Fbxw17 G A 13: 50,577,255 (GRCm39) R49Q probably damaging Het
Garin2 T A 12: 78,762,060 (GRCm39) D241E probably damaging Het
Gm10332 T A 14: 55,057,616 (GRCm39) F59I probably damaging Het
Gnai3 A G 3: 108,030,852 (GRCm39) probably null Het
Helz T A 11: 107,523,087 (GRCm39) M75K possibly damaging Het
Hnrnph3 C T 10: 62,854,672 (GRCm39) probably benign Het
Ifi211 C T 1: 173,733,118 (GRCm39) C181Y probably benign Het
Immp1l A G 2: 105,767,390 (GRCm39) K83R probably damaging Het
Itga6 G A 2: 71,671,468 (GRCm39) G740R probably damaging Het
Klhl1 T C 14: 96,755,354 (GRCm39) T134A probably benign Het
Klhl7 A G 5: 24,354,244 (GRCm39) D353G probably damaging Het
Map3k1 A G 13: 111,888,983 (GRCm39) S1325P probably benign Het
Map3k4 A G 17: 12,451,297 (GRCm39) probably null Het
Meioc G A 11: 102,559,286 (GRCm39) probably null Het
Mfap5 T C 6: 122,497,555 (GRCm39) F26L probably damaging Het
Myo5a A G 9: 75,054,249 (GRCm39) T386A probably damaging Het
Npc1l1 A T 11: 6,164,013 (GRCm39) L1266Q probably damaging Het
Npc1l1 G T 11: 6,164,014 (GRCm39) L1266M probably damaging Het
Or4c116 A G 2: 88,942,325 (GRCm39) M177T probably benign Het
Or51aa2 C A 7: 103,188,265 (GRCm39) V59F possibly damaging Het
Pbld1 T A 10: 62,910,842 (GRCm39) S233T probably damaging Het
Phf12 A G 11: 77,916,918 (GRCm39) *789W probably null Het
Sf3b2 A T 19: 5,329,992 (GRCm39) probably null Het
Slc23a3 A G 1: 75,105,191 (GRCm39) I459T probably damaging Het
Spata31e4 A G 13: 50,856,071 (GRCm39) T570A possibly damaging Het
Sptbn2 C G 19: 4,799,040 (GRCm39) R2037G probably benign Het
Stard9 A C 2: 120,526,253 (GRCm39) M837L probably benign Het
Stx5a A T 19: 8,732,612 (GRCm39) probably benign Het
Tmc7 A G 7: 118,137,385 (GRCm39) V719A probably benign Het
Trank1 T A 9: 111,193,902 (GRCm39) I642K possibly damaging Het
Trim34a T C 7: 103,910,244 (GRCm39) Y349H probably damaging Het
Uba7 A G 9: 107,858,671 (GRCm39) Y834C possibly damaging Het
Vps13a A G 19: 16,722,283 (GRCm39) V343A possibly damaging Het
Zbtb37 G A 1: 160,859,643 (GRCm39) Q221* probably null Het
Zfp119b T C 17: 56,246,148 (GRCm39) N346S probably benign Het
Zfp708 G T 13: 67,218,785 (GRCm39) T358K possibly damaging Het
Other mutations in Ube2d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Ube2d1 APN 10 71,091,656 (GRCm39) utr 3 prime probably benign
IGL01695:Ube2d1 APN 10 71,098,082 (GRCm39) missense probably damaging 0.99
R0669:Ube2d1 UTSW 10 71,097,940 (GRCm39) missense probably benign 0.00
R1616:Ube2d1 UTSW 10 71,092,523 (GRCm39) missense probably damaging 1.00
R1954:Ube2d1 UTSW 10 71,120,953 (GRCm39) start codon destroyed probably null 0.94
R4177:Ube2d1 UTSW 10 71,094,033 (GRCm39) missense probably damaging 0.98
R5440:Ube2d1 UTSW 10 71,091,682 (GRCm39) missense probably damaging 0.98
R5889:Ube2d1 UTSW 10 71,095,699 (GRCm39) intron probably benign
R6562:Ube2d1 UTSW 10 71,098,071 (GRCm39) missense probably benign 0.27
R7227:Ube2d1 UTSW 10 71,091,702 (GRCm39) missense possibly damaging 0.54
R8707:Ube2d1 UTSW 10 71,092,478 (GRCm39) missense probably benign 0.17
R9237:Ube2d1 UTSW 10 71,097,925 (GRCm39) missense probably damaging 1.00
R9505:Ube2d1 UTSW 10 71,098,094 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GGTCACAGCACAGACATGTAC -3'
(R):5'- CAAGCCATCTGTCACTGAGC -3'

Sequencing Primer
(F):5'- GGTCACAGCACAGACATGTACTATTC -3'
(R):5'- ATCTGTCACTGAGCCACACTC -3'
Posted On 2018-06-22