Incidental Mutation 'R6580:Gtf2ird1'
ID 524076
Institutional Source Beutler Lab
Gene Symbol Gtf2ird1
Ensembl Gene ENSMUSG00000023079
Gene Name general transcription factor II I repeat domain-containing 1
Synonyms ESTM9, BEN, binding factor for early enhancer, MusTRD1, GTF3, Cream1, WBSCR11
MMRRC Submission 044704-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.696) question?
Stock # R6580 (G1)
Quality Score 133.008
Status Validated
Chromosome 5
Chromosomal Location 134386510-134485570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 134389893 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Histidine at position 920 (N920H)
Ref Sequence ENSEMBL: ENSMUSP00000106876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073161] [ENSMUST00000074114] [ENSMUST00000100650] [ENSMUST00000100652] [ENSMUST00000100654] [ENSMUST00000111244] [ENSMUST00000111245] [ENSMUST00000167084] [ENSMUST00000171794] [ENSMUST00000202104] [ENSMUST00000202554] [ENSMUST00000202829] [ENSMUST00000200944] [ENSMUST00000202280] [ENSMUST00000202321] [ENSMUST00000202165]
AlphaFold Q9JI57
Predicted Effect probably damaging
Transcript: ENSMUST00000073161
AA Change: N966H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000072904
Gene: ENSMUSG00000023079
AA Change: N966H

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 814 889 1.7e-34 PFAM
Pfam:GTF2I 917 992 1.7e-34 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074114
SMART Domains Protein: ENSMUSP00000073752
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.5e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 690 765 2.8e-34 PFAM
Pfam:GTF2I 814 889 1.6e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100650
AA Change: N939H

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000098215
Gene: ENSMUSG00000023079
AA Change: N939H

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.5e-29 PFAM
Pfam:GTF2I 351 426 4.9e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.2e-34 PFAM
Pfam:GTF2I 690 765 3.1e-34 PFAM
Pfam:GTF2I 787 862 1.8e-34 PFAM
Pfam:GTF2I 890 965 1.8e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100652
AA Change: N966H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098217
Gene: ENSMUSG00000023079
AA Change: N966H

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.8e-29 PFAM
Pfam:GTF2I 351 425 6.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.3e-34 PFAM
Pfam:GTF2I 690 764 3.3e-32 PFAM
Pfam:GTF2I 814 888 3e-33 PFAM
Pfam:GTF2I 917 991 3e-33 PFAM
low complexity region 1020 1043 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100654
AA Change: N868H

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000098219
Gene: ENSMUSG00000023079
AA Change: N868H

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 716 791 1.5e-34 PFAM
Pfam:GTF2I 819 894 1.5e-34 PFAM
low complexity region 922 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111244
AA Change: N939H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106875
Gene: ENSMUSG00000023079
AA Change: N939H

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.3e-29 PFAM
Pfam:GTF2I 351 425 4.9e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1.7e-34 PFAM
Pfam:GTF2I 690 764 2.5e-32 PFAM
Pfam:GTF2I 787 861 2.3e-33 PFAM
Pfam:GTF2I 890 964 2.3e-33 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111245
AA Change: N920H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106876
Gene: ENSMUSG00000023079
AA Change: N920H

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.4e-29 PFAM
Pfam:GTF2I 351 426 4.6e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1.1e-34 PFAM
Pfam:GTF2I 671 746 2.9e-34 PFAM
Pfam:GTF2I 768 843 1.7e-34 PFAM
Pfam:GTF2I 871 946 1.7e-34 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167084
AA Change: N863H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132882
Gene: ENSMUSG00000023079
AA Change: N863H

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.3e-29 PFAM
Pfam:GTF2I 351 426 4.3e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 1e-34 PFAM
Pfam:GTF2I 690 765 2.7e-34 PFAM
Pfam:GTF2I 814 889 1.5e-34 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171794
AA Change: N939H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129392
Gene: ENSMUSG00000023079
AA Change: N939H

DomainStartEndE-ValueType
Pfam:GTF2I 128 203 1.2e-29 PFAM
Pfam:GTF2I 351 426 3.8e-33 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 640 8.9e-35 PFAM
Pfam:GTF2I 690 765 2.4e-34 PFAM
Pfam:GTF2I 787 862 1.4e-34 PFAM
Pfam:GTF2I 890 965 1.4e-34 PFAM
low complexity region 993 1016 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000202104
AA Change: N107H

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000144203
Gene: ENSMUSG00000023079
AA Change: N107H

DomainStartEndE-ValueType
Pfam:GTF2I 1 29 7.9e-7 PFAM
Pfam:GTF2I 58 132 7.3e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000202554
AA Change: N920H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143809
Gene: ENSMUSG00000023079
AA Change: N920H

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 5.5e-29 PFAM
Pfam:GTF2I 351 425 6.3e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2.2e-34 PFAM
Pfam:GTF2I 671 745 3.2e-32 PFAM
Pfam:GTF2I 768 842 2.9e-33 PFAM
Pfam:GTF2I 871 945 2.9e-33 PFAM
low complexity region 974 997 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202829
AA Change: N239H

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000144604
Gene: ENSMUSG00000023079
AA Change: N239H

DomainStartEndE-ValueType
Pfam:GTF2I 1 44 1.4e-15 PFAM
Pfam:GTF2I 87 161 4.6e-34 PFAM
Pfam:GTF2I 190 264 4.6e-34 PFAM
low complexity region 293 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200944
SMART Domains Protein: ENSMUSP00000143848
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 4.9e-29 PFAM
Pfam:GTF2I 351 425 5.6e-32 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 2e-34 PFAM
Pfam:GTF2I 690 764 2.8e-32 PFAM
Pfam:GTF2I 814 888 2.6e-33 PFAM
low complexity region 917 940 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202280
SMART Domains Protein: ENSMUSP00000143897
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
Pfam:GTF2I 128 202 2.6e-26 PFAM
Pfam:GTF2I 351 425 2.9e-29 PFAM
low complexity region 543 558 N/A INTRINSIC
Pfam:GTF2I 565 639 1e-31 PFAM
Pfam:GTF2I 690 764 1.5e-29 PFAM
Pfam:GTF2I 787 861 1.3e-30 PFAM
low complexity region 890 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202321
Predicted Effect probably benign
Transcript: ENSMUST00000202165
SMART Domains Protein: ENSMUSP00000144420
Gene: ENSMUSG00000023079

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:GTF2I 35 109 7.6e-33 PFAM
Pfam:GTF2I 167 193 4.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202268
Predicted Effect probably benign
Transcript: ENSMUST00000201495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201608
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 93.2%
Validation Efficiency 97% (32/33)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains five GTF2I-like repeats and each repeat possesses a potential helix-loop-helix (HLH) motif. It may have the ability to interact with other HLH-proteins and function as a transcription factor or as a positive transcriptional regulator under the control of Retinoblastoma protein. This gene plays a role in craniofacial and cognitive development and mutations have been associated with Williams-Beuren syndrome, a multisystem developmental disorder caused by deletion of multiple genes at 7q11.23. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygotes for one null allele is embryonic lethal with abnormal yolk sac vasulogenesis, abnormal angiogenesis, and neural tube defect. Other null allele homozygous mice are viable and have behavioral defects and exhibit a mild craniofacial defect withvariable penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik G A 3: 137,772,386 (GRCm39) R525H probably benign Het
Acox3 T A 5: 35,765,747 (GRCm39) L600Q probably damaging Het
Ankrd49 A G 9: 14,692,694 (GRCm39) S157P probably damaging Het
Ccdc141 A G 2: 76,842,099 (GRCm39) F1444S possibly damaging Het
Cimap2 G T 4: 106,468,711 (GRCm39) H271N possibly damaging Het
Defb28 C T 2: 152,360,215 (GRCm39) S10L possibly damaging Het
Epha6 T G 16: 59,502,979 (GRCm39) N976T probably damaging Het
Gm45861 A G 8: 28,034,979 (GRCm39) K976E unknown Het
Gtf3c1 A T 7: 125,243,519 (GRCm39) M1695K probably benign Het
Hfm1 C T 5: 106,995,575 (GRCm39) E1279K probably benign Het
Il31ra C T 13: 112,688,476 (GRCm39) D34N possibly damaging Het
Klhl3 T A 13: 58,166,701 (GRCm39) I430F possibly damaging Het
Mfhas1 A G 8: 36,056,419 (GRCm39) Y298C probably damaging Het
Muc20 A T 16: 32,613,859 (GRCm39) M506K possibly damaging Het
Myo1c C T 11: 75,562,461 (GRCm39) P918S probably benign Het
Naip1 T A 13: 100,581,157 (GRCm39) D30V probably damaging Het
Nol9 A G 4: 152,136,218 (GRCm39) N430S probably benign Het
Or8b44 T C 9: 38,410,319 (GRCm39) M118T probably damaging Het
Palm3 A G 8: 84,756,177 (GRCm39) E563G probably damaging Het
Pcdhga4 A G 18: 37,820,370 (GRCm39) S640G possibly damaging Het
Pi4ka A G 16: 17,168,694 (GRCm39) F679L probably damaging Het
Pierce1 A G 2: 28,356,062 (GRCm39) W74R probably damaging Het
Polr3c A G 3: 96,634,659 (GRCm39) probably null Het
Ptdss2 T A 7: 140,732,925 (GRCm39) I236N probably damaging Het
Rapgef1 A G 2: 29,620,621 (GRCm39) Y879C possibly damaging Het
Shc3 T C 13: 51,596,809 (GRCm39) T405A probably benign Het
Smtnl2 G T 11: 72,293,859 (GRCm39) S232R probably benign Het
Taar8a G A 10: 23,952,791 (GRCm39) A132T probably damaging Het
Tex47 T C 5: 7,355,212 (GRCm39) I131T probably damaging Het
Tiam2 CGGG CGGGG 17: 3,464,897 (GRCm39) probably null Het
Vmn1r63 A G 7: 5,805,913 (GRCm39) S240P probably benign Het
Vmn2r130 T C 17: 23,282,740 (GRCm39) V140A probably benign Het
Vmn2r84 A G 10: 130,225,110 (GRCm39) W467R possibly damaging Het
Zscan12 T C 13: 21,553,328 (GRCm39) L384P probably damaging Het
Other mutations in Gtf2ird1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00558:Gtf2ird1 APN 5 134,387,745 (GRCm39) missense probably benign 0.03
IGL02477:Gtf2ird1 APN 5 134,408,832 (GRCm39) missense probably damaging 1.00
IGL02659:Gtf2ird1 APN 5 134,405,895 (GRCm39) missense probably damaging 1.00
IGL02752:Gtf2ird1 APN 5 134,387,678 (GRCm39) makesense probably null
IGL02963:Gtf2ird1 APN 5 134,418,541 (GRCm39) missense probably benign 0.05
IGL03328:Gtf2ird1 APN 5 134,417,983 (GRCm39) critical splice donor site probably null
IGL03379:Gtf2ird1 APN 5 134,411,392 (GRCm39) missense possibly damaging 0.94
R0585:Gtf2ird1 UTSW 5 134,405,796 (GRCm39) missense probably damaging 1.00
R1199:Gtf2ird1 UTSW 5 134,439,918 (GRCm39) missense possibly damaging 0.85
R1388:Gtf2ird1 UTSW 5 134,424,564 (GRCm39) missense probably damaging 1.00
R1470:Gtf2ird1 UTSW 5 134,424,656 (GRCm39) critical splice acceptor site probably null
R1470:Gtf2ird1 UTSW 5 134,424,656 (GRCm39) critical splice acceptor site probably null
R1544:Gtf2ird1 UTSW 5 134,387,772 (GRCm39) missense possibly damaging 0.93
R1652:Gtf2ird1 UTSW 5 134,424,567 (GRCm39) missense probably damaging 1.00
R1792:Gtf2ird1 UTSW 5 134,395,790 (GRCm39) splice site probably null
R1852:Gtf2ird1 UTSW 5 134,411,434 (GRCm39) splice site probably null
R1938:Gtf2ird1 UTSW 5 134,444,099 (GRCm39) missense probably damaging 1.00
R1996:Gtf2ird1 UTSW 5 134,405,740 (GRCm39) splice site probably benign
R2020:Gtf2ird1 UTSW 5 134,445,947 (GRCm39) missense probably damaging 1.00
R2025:Gtf2ird1 UTSW 5 134,392,788 (GRCm39) missense probably damaging 1.00
R2849:Gtf2ird1 UTSW 5 134,387,861 (GRCm39) missense probably damaging 1.00
R2964:Gtf2ird1 UTSW 5 134,386,538 (GRCm39) splice site probably null
R3421:Gtf2ird1 UTSW 5 134,417,354 (GRCm39) missense probably benign 0.41
R4543:Gtf2ird1 UTSW 5 134,392,754 (GRCm39) critical splice donor site probably null
R4569:Gtf2ird1 UTSW 5 134,439,857 (GRCm39) missense probably damaging 1.00
R4664:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4665:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4666:Gtf2ird1 UTSW 5 134,412,756 (GRCm39) missense probably damaging 1.00
R4680:Gtf2ird1 UTSW 5 134,386,735 (GRCm39) missense probably damaging 1.00
R4709:Gtf2ird1 UTSW 5 134,433,588 (GRCm39) missense probably benign
R4806:Gtf2ird1 UTSW 5 134,412,750 (GRCm39) missense probably damaging 0.99
R4823:Gtf2ird1 UTSW 5 134,424,576 (GRCm39) missense probably damaging 1.00
R4857:Gtf2ird1 UTSW 5 134,391,398 (GRCm39) missense probably damaging 0.96
R4970:Gtf2ird1 UTSW 5 134,431,038 (GRCm39) missense probably damaging 1.00
R4974:Gtf2ird1 UTSW 5 134,386,685 (GRCm39) nonsense probably null
R4975:Gtf2ird1 UTSW 5 134,424,481 (GRCm39) missense probably damaging 1.00
R5072:Gtf2ird1 UTSW 5 134,419,787 (GRCm39) splice site probably null
R5112:Gtf2ird1 UTSW 5 134,431,038 (GRCm39) missense probably damaging 1.00
R5653:Gtf2ird1 UTSW 5 134,439,821 (GRCm39) missense probably damaging 1.00
R5681:Gtf2ird1 UTSW 5 134,392,172 (GRCm39) missense probably damaging 1.00
R5738:Gtf2ird1 UTSW 5 134,412,672 (GRCm39) missense probably damaging 1.00
R5753:Gtf2ird1 UTSW 5 134,439,837 (GRCm39) missense probably damaging 1.00
R6385:Gtf2ird1 UTSW 5 134,433,544 (GRCm39) missense probably benign 0.19
R6787:Gtf2ird1 UTSW 5 134,392,766 (GRCm39) missense probably damaging 0.99
R6981:Gtf2ird1 UTSW 5 134,412,776 (GRCm39) splice site probably benign
R7208:Gtf2ird1 UTSW 5 134,439,948 (GRCm39) missense probably benign 0.35
R7271:Gtf2ird1 UTSW 5 134,433,758 (GRCm39) missense probably benign 0.01
R7517:Gtf2ird1 UTSW 5 134,391,379 (GRCm39) missense probably benign
R7786:Gtf2ird1 UTSW 5 134,419,753 (GRCm39) nonsense probably null
R7788:Gtf2ird1 UTSW 5 134,445,985 (GRCm39) nonsense probably null
R7850:Gtf2ird1 UTSW 5 134,392,069 (GRCm39) missense probably benign 0.21
R7866:Gtf2ird1 UTSW 5 134,392,063 (GRCm39) missense probably benign 0.01
R8183:Gtf2ird1 UTSW 5 134,386,689 (GRCm39) missense unknown
R8712:Gtf2ird1 UTSW 5 134,444,064 (GRCm39) missense probably damaging 1.00
R8844:Gtf2ird1 UTSW 5 134,389,879 (GRCm39) nonsense probably null
R9473:Gtf2ird1 UTSW 5 134,433,534 (GRCm39) missense probably benign 0.08
R9669:Gtf2ird1 UTSW 5 134,408,794 (GRCm39) missense probably damaging 0.99
R9737:Gtf2ird1 UTSW 5 134,408,794 (GRCm39) missense probably damaging 0.99
X0026:Gtf2ird1 UTSW 5 134,404,956 (GRCm39) splice site probably null
Z1176:Gtf2ird1 UTSW 5 134,438,166 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GATCTTCTGACTCAGGAGCCTG -3'
(R):5'- AGTTGGGCTGTCAGAGTCATAATC -3'

Sequencing Primer
(F):5'- GTCTCTGACAGACCACTGCTGAC -3'
(R):5'- AGAGTCATAATCTTCTCCCCAGAGTG -3'
Posted On 2018-06-22