Mutagenetix > Incidental Mutation

Incidental Mutation 'R6535:Apobec3'

520355

Institutional Source

Beutler Lab

Gene Symbol

Apobec3

Ensembl Gene

ENSMUSG00000009585

Gene Name

apolipoprotein B mRNA editing enzyme, catalytic polypeptide 3

Synonyms

Rfv-3, Gm20117, Rfv3, CEM15

MMRRC Submission

044661-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6535 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

79775860-79800107 bp(+) (GRCm39)

Type of Mutation

makesense

DNA Base Change (assembly)

A to G at 79781950 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Stop codon to Tryptophan at position 47 (*47W)

Ref Sequence

ENSEMBL: ENSMUSP00000135507 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023054] [ENSMUST00000109620] [ENSMUST00000165537] [ENSMUST00000175714] [ENSMUST00000175752] [ENSMUST00000176868] [ENSMUST00000177006] [ENSMUST00000176325] [ENSMUST00000177098] [ENSMUST00000176904] [ENSMUST00000177483] [ENSMUST00000177350] [ENSMUST00000230135] [ENSMUST00000230741]

AlphaFold

Q99J72

Predicted Effect

probably benign
Transcript: ENSMUST00000023054

SMART Domains

Protein: ENSMUSP00000023054
Gene: ENSMUSG00000009585

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	1	99	6.5e-22	PFAM
Pfam:APOBEC_C	37	91	2.8e-23	PFAM
Pfam:APOBEC_N	106	276	4.4e-28	PFAM
Pfam:APOBEC_C	215	268	1.5e-21	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109620
AA Change: K86E

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000105249
Gene: ENSMUSG00000009585
AA Change: K86E

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	21	198	6.5e-37	PFAM
Pfam:APOBEC_C	136	190	4.9e-23	PFAM
low complexity region	203	213	N/A	INTRINSIC
Pfam:APOBEC_N	238	408	1.1e-27	PFAM
Pfam:APOBEC_C	347	400	2.5e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000165537
AA Change: K86E

PolyPhen 2 Score 0.407 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000132391
Gene: ENSMUSG00000009585
AA Change: K86E

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	21	198	5.4e-37	PFAM
Pfam:APOBEC_C	136	190	4.3e-23	PFAM
Pfam:APOBEC_N	205	375	9e-28	PFAM
Pfam:APOBEC_C	314	367	2.3e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175714
AA Change: K97E

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000135027
Gene: ENSMUSG00000009585
AA Change: K97E

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	37	206	1.1e-57	PFAM
Pfam:APOBEC_C	148	199	2e-22	PFAM
low complexity region	214	224	N/A	INTRINSIC
Pfam:APOBEC_N	253	416	7.6e-33	PFAM
Pfam:APOBEC_C	359	409	3.7e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000175752
AA Change: K97E

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000135358
Gene: ENSMUSG00000009585
AA Change: K97E

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	32	209	7.9e-37	PFAM
Pfam:APOBEC_C	147	201	6.3e-23	PFAM
Pfam:APOBEC_N	216	386	1.3e-27	PFAM
Pfam:APOBEC_C	325	378	3.3e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175801

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175849

Predicted Effect

probably null
Transcript: ENSMUST00000176868
AA Change: *80W

Predicted Effect

probably null
Transcript: ENSMUST00000177006
AA Change: *47W

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176325
AA Change: K97E

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000134838
Gene: ENSMUSG00000009585
AA Change: K97E

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	32	209	9e-37	PFAM
Pfam:APOBEC_C	147	201	6.8e-23	PFAM
low complexity region	214	224	N/A	INTRINSIC
Pfam:APOBEC_N	249	419	1.5e-27	PFAM
Pfam:APOBEC_C	358	411	3.6e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177098
AA Change: K97E

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000135079
Gene: ENSMUSG00000009585
AA Change: K97E

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	31	209	6.8e-37	PFAM
Pfam:APOBEC_C	147	201	6e-23	PFAM
Pfam:APOBEC_N	216	386	1.2e-27	PFAM
Pfam:APOBEC_C	325	378	3.1e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176823

Predicted Effect

probably benign
Transcript: ENSMUST00000176904

SMART Domains

Protein: ENSMUSP00000135502
Gene: ENSMUSG00000009585

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	1	84	7.4e-21	PFAM
Pfam:APOBEC_C	37	85	2.7e-22	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177483

SMART Domains

Protein: ENSMUSP00000135011
Gene: ENSMUSG00000009585

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	1	99	1.3e-22	PFAM
Pfam:APOBEC_C	37	91	8.1e-24	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000177350

SMART Domains

Protein: ENSMUSP00000134938
Gene: ENSMUSG00000009585

Domain	Start	End	E-Value	Type
Pfam:APOBEC_N	1	99	1.6e-22	PFAM
Pfam:APOBEC_C	37	91	9.8e-24	PFAM
low complexity region	104	114	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176644

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230175

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230410

Predicted Effect

probably benign
Transcript: ENSMUST00000230135

Predicted Effect

probably benign
Transcript: ENSMUST00000230741

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cytidine deaminase gene family. It is one of seven related genes or pseudogenes found in a cluster, thought to result from gene duplication, on chromosome 22. Members of the cluster encode proteins that are structurally and functionally related to the C to U RNA-editing cytidine deaminase APOBEC1. It is thought that the proteins may be RNA editing enzymes and have roles in growth or cell cycle control. A hybrid gene results from the deletion of approximately 29.5 kb of sequence between this gene, APOBEC3B, and the adjacent gene APOBEC3A. The breakpoints of the deletion are within the two genes, so the deletion allele is predicted to have the promoter and coding region of APOBEC3A, but the 3' UTR of APOBEC3B. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele display more rapid and extensive spread of viral infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 27 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrf5	G	A	17: 43,750,920 (GRCm39)	S495N	probably benign	Het
Ank3	G	T	10: 69,713,684 (GRCm39)	A448S	probably damaging	Het
B4gat1	T	C	19: 5,089,558 (GRCm39)	V185A	possibly damaging	Het
Cers1	T	A	8: 70,782,804 (GRCm39)	V58D	probably damaging	Het
Chrm1	T	A	19: 8,656,437 (GRCm39)	Y381N	possibly damaging	Het
Cpne6	A	T	14: 55,751,122 (GRCm39)	E177V	probably benign	Het
Cpt1a	T	A	19: 3,415,788 (GRCm39)		probably null	Het
Ctsq	A	T	13: 61,183,140 (GRCm39)	I334N	probably damaging	Het
Dennd6b	A	G	15: 89,070,570 (GRCm39)	L400P	probably damaging	Het
Fam135b	A	G	15: 71,493,924 (GRCm39)	S2P	probably damaging	Het
Hip1	T	C	5: 135,457,351 (GRCm39)		probably null	Het
Lama2	A	C	10: 26,980,127 (GRCm39)	L1896R	probably damaging	Het
Ly6g6g	T	C	15: 74,644,074 (GRCm39)	S81G	probably damaging	Het
Macf1	A	T	4: 123,365,728 (GRCm39)	V3011D	possibly damaging	Het
Macrod1	A	G	19: 7,034,515 (GRCm39)	D86G	probably damaging	Het
Mettl8	G	T	2: 70,803,733 (GRCm39)	H185N	possibly damaging	Het
Mipol1	A	C	12: 57,352,886 (GRCm39)	Q75P	possibly damaging	Het
Pi4ka	C	T	16: 17,118,900 (GRCm39)	V125M	probably damaging	Het
Pole	A	C	5: 110,472,673 (GRCm39)	Y1618S	probably damaging	Het
Prrc2a	A	G	17: 35,381,241 (GRCm39)	V21A	unknown	Het
Rhbdl1	A	T	17: 26,054,799 (GRCm39)	Y111*	probably null	Het
Sbk3	A	C	7: 4,972,840 (GRCm39)	M110R	possibly damaging	Het
Scn8a	G	A	15: 100,857,588 (GRCm39)		probably benign	Het
Tcstv2c	T	C	13: 120,616,190 (GRCm39)	S10P	probably damaging	Het
Tshz3	T	C	7: 36,468,214 (GRCm39)	S68P	probably damaging	Het
Vmn1r88	C	T	7: 12,912,112 (GRCm39)	T156I	probably benign	Het
Wrn	T	C	8: 33,826,131 (GRCm39)	H177R	probably damaging	Het

Other mutations in Apobec3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02529:Apobec3	APN	15	79,781,888 (GRCm39)	unclassified	probably benign
R1863:Apobec3	UTSW	15	79,782,068 (GRCm39)	missense	possibly damaging	0.58
R1885:Apobec3	UTSW	15	79,781,906 (GRCm39)	missense	probably damaging	1.00
R3815:Apobec3	UTSW	15	79,783,301 (GRCm39)	missense	possibly damaging	0.95
R4175:Apobec3	UTSW	15	79,779,653 (GRCm39)	missense	probably damaging	1.00
R4677:Apobec3	UTSW	15	79,779,713 (GRCm39)	missense	probably damaging	0.99
R4780:Apobec3	UTSW	15	79,783,225 (GRCm39)	missense	possibly damaging	0.84
R5540:Apobec3	UTSW	15	79,782,120 (GRCm39)	missense	probably benign	0.01
R5830:Apobec3	UTSW	15	79,783,268 (GRCm39)	missense	possibly damaging	0.84
R5945:Apobec3	UTSW	15	79,782,047 (GRCm39)	missense	probably damaging	1.00
R9222:Apobec3	UTSW	15	79,783,270 (GRCm39)	missense
R9280:Apobec3	UTSW	15	79,791,082 (GRCm39)	missense
R9594:Apobec3	UTSW	15	79,790,653 (GRCm39)	missense
X0066:Apobec3	UTSW	15	79,789,725 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATGCCCTGAATGCTGAGGG -3'
(R):5'- TATAGGTCCATGGCAGCCAC -3'

Sequencing Primer
(F):5'- CCTGAATGCTGAGGGACACG -3'
(R):5'- AGCCTGCAAAGATTCTGCTG -3'

Posted On

2018-06-06