Incidental Mutation 'R6371:Inpp5d'
ID 513505
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Name inositol polyphosphate-5-phosphatase D
Synonyms SHIP1, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP, SHIP-1
MMRRC Submission 044521-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.914) question?
Stock # R6371 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 87548034-87648229 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 87627397 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 566 (L566Q)
Ref Sequence ENSEMBL: ENSMUSP00000127941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]
AlphaFold Q9ES52
Predicted Effect probably damaging
Transcript: ENSMUST00000042275
AA Change: L565Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: L565Q

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000072999
AA Change: L565Q

PolyPhen 2 Score 0.839 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288
AA Change: L565Q

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167032
AA Change: L303Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: L303Q

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000168783
AA Change: L566Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: L566Q

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169754
AA Change: L566Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: L566Q

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170300
AA Change: L303Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: L303Q

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Meta Mutation Damage Score 0.9048 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.7%
  • 10x: 98.2%
  • 20x: 94.1%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam6b C T 12: 113,453,894 (GRCm39) S237L probably damaging Het
Ank3 T G 10: 69,644,709 (GRCm39) L58V probably damaging Het
Arsb A T 13: 93,926,574 (GRCm39) I115F possibly damaging Het
Atad2b T C 12: 5,023,970 (GRCm39) Y32H probably damaging Het
Brd1 A C 15: 88,598,201 (GRCm39) M515R probably benign Het
Cbx7 A G 15: 79,803,023 (GRCm39) S30P possibly damaging Het
Cdk12 A G 11: 98,136,114 (GRCm39) T1123A unknown Het
Cep170b A G 12: 112,707,379 (GRCm39) D375G probably damaging Het
Clcn3 T C 8: 61,390,369 (GRCm39) K164E probably benign Het
Clip4 A C 17: 72,163,459 (GRCm39) K677T probably damaging Het
Clrn2 T C 5: 45,617,540 (GRCm39) I137T possibly damaging Het
Cntln T C 4: 84,802,816 (GRCm39) S39P probably damaging Het
Crocc2 T A 1: 93,143,353 (GRCm39) N1318K probably benign Het
Emc1 C T 4: 139,098,976 (GRCm39) Q820* probably null Het
Fbxl2 G A 9: 113,818,451 (GRCm39) T170I probably damaging Het
Fyb2 A G 4: 104,852,975 (GRCm39) T552A probably damaging Het
Garin5b A G 7: 4,762,358 (GRCm39) V257A probably benign Het
Gm2381 G A 7: 42,470,010 (GRCm39) A38V probably benign Het
Gpt2 G A 8: 86,244,681 (GRCm39) E325K probably benign Het
Helz2 C T 2: 180,875,260 (GRCm39) E1745K probably damaging Het
Hspg2 T C 4: 137,269,006 (GRCm39) Y2213H probably damaging Het
Ifnar2 T C 16: 91,184,986 (GRCm39) Y24H possibly damaging Het
Itgb2 C A 10: 77,384,431 (GRCm39) P184H probably damaging Het
Kcnb2 T A 1: 15,781,436 (GRCm39) D769E probably benign Het
Lrp1b A G 2: 40,741,666 (GRCm39) M3087T possibly damaging Het
Ltbp3 A G 19: 5,795,800 (GRCm39) probably null Het
Ms4a6b A G 19: 11,497,728 (GRCm39) E9G probably damaging Het
Nat3 G A 8: 67,976,831 (GRCm39) probably null Het
Ndufaf1 A T 2: 119,490,534 (GRCm39) D175E probably damaging Het
Nop58 T G 1: 59,750,471 (GRCm39) probably benign Het
Or10al6 A G 17: 38,083,326 (GRCm39) T261A probably benign Het
Or8s16 A G 15: 98,211,219 (GRCm39) Y71H possibly damaging Het
P3h4 C T 11: 100,302,575 (GRCm39) E354K probably benign Het
Plekhm2 T G 4: 141,356,843 (GRCm39) T787P possibly damaging Het
Ppia C T 11: 6,368,230 (GRCm39) T37I probably benign Het
Reln T A 5: 22,200,511 (GRCm39) M1330L probably benign Het
Ric1 A G 19: 29,539,426 (GRCm39) E53G probably benign Het
Sgip1 T A 4: 102,823,482 (GRCm39) V721E probably damaging Het
Slc33a1 A T 3: 63,850,709 (GRCm39) D538E probably benign Het
Son T C 16: 91,471,629 (GRCm39) Het
Srebf1 A T 11: 60,094,341 (GRCm39) S591R probably damaging Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Taok2 G A 7: 126,469,319 (GRCm39) R1170W probably damaging Het
Tsc2 A T 17: 24,845,688 (GRCm39) V210E probably benign Het
Ttc6 T A 12: 57,775,249 (GRCm39) N1648K possibly damaging Het
Vgll3 C T 16: 65,636,131 (GRCm39) P94L probably damaging Het
Vmn2r54 A T 7: 12,349,362 (GRCm39) V740E probably damaging Het
Yeats2 A G 16: 20,040,460 (GRCm39) E1127G possibly damaging Het
Zfp709 T A 8: 72,643,329 (GRCm39) Y252N probably damaging Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87,611,537 (GRCm39) missense probably benign 0.00
IGL00329:Inpp5d APN 1 87,595,725 (GRCm39) missense probably benign 0.00
IGL00897:Inpp5d APN 1 87,639,836 (GRCm39) missense probably benign 0.14
IGL01314:Inpp5d APN 1 87,611,472 (GRCm39) nonsense probably null
IGL02145:Inpp5d APN 1 87,642,777 (GRCm39) missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87,635,854 (GRCm39) missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87,623,088 (GRCm39) missense probably null 0.92
IGL02680:Inpp5d APN 1 87,629,205 (GRCm39) missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87,638,863 (GRCm39) missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87,630,919 (GRCm39) missense probably damaging 1.00
americas UTSW 1 87,642,864 (GRCm39) missense probably damaging 1.00
Apfelsine UTSW 1 87,611,567 (GRCm39) nonsense probably null
Auburn UTSW 1 87,609,402 (GRCm39) splice site probably null
Autumnal UTSW 1 87,619,433 (GRCm39) missense probably damaging 0.97
Gourd UTSW 1 87,625,337 (GRCm39) intron probably benign
lyda UTSW 1 87,611,484 (GRCm39) missense probably damaging 1.00
Mandarin UTSW 1 87,637,348 (GRCm39) missense probably damaging 0.99
naranjo UTSW 1 87,635,933 (GRCm39) critical splice donor site probably null
New_black UTSW 1 87,637,397 (GRCm39) missense probably damaging 1.00
Orange UTSW 1 87,625,268 (GRCm39) critical splice donor site probably null
pantone UTSW 1 87,627,397 (GRCm39) missense probably damaging 1.00
sailing UTSW 1 87,633,686 (GRCm39) missense probably damaging 1.00
Salamander UTSW 1 87,623,102 (GRCm39) missense probably damaging 0.99
Sandstone UTSW 1 87,623,122 (GRCm39) missense probably damaging 1.00
styx UTSW 1 87,597,506 (GRCm39) critical splice donor site probably benign
tangerine UTSW 1 87,633,671 (GRCm39) missense probably damaging 1.00
ulster UTSW 1 87,629,198 (GRCm39) nonsense probably null
R0010:Inpp5d UTSW 1 87,625,268 (GRCm39) critical splice donor site probably null
R0037:Inpp5d UTSW 1 87,635,851 (GRCm39) missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87,642,860 (GRCm39) missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87,625,872 (GRCm39) missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87,633,642 (GRCm39) splice site probably benign
R0733:Inpp5d UTSW 1 87,595,799 (GRCm39) splice site probably benign
R1464:Inpp5d UTSW 1 87,625,827 (GRCm39) splice site probably benign
R1576:Inpp5d UTSW 1 87,609,280 (GRCm39) missense probably damaging 0.96
R1576:Inpp5d UTSW 1 87,597,407 (GRCm39) missense probably benign 0.16
R1592:Inpp5d UTSW 1 87,593,254 (GRCm39) missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87,626,803 (GRCm39) missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87,595,611 (GRCm39) missense probably benign 0.30
R1972:Inpp5d UTSW 1 87,604,036 (GRCm39) missense probably benign 0.00
R2024:Inpp5d UTSW 1 87,623,072 (GRCm39) nonsense probably null
R2405:Inpp5d UTSW 1 87,627,451 (GRCm39) missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87,595,779 (GRCm39) missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87,595,779 (GRCm39) missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87,629,130 (GRCm39) splice site probably benign
R4652:Inpp5d UTSW 1 87,593,173 (GRCm39) missense probably benign 0.03
R4676:Inpp5d UTSW 1 87,642,864 (GRCm39) missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87,625,245 (GRCm39) missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87,633,686 (GRCm39) missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87,604,064 (GRCm39) missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87,637,397 (GRCm39) missense probably damaging 1.00
R5442:Inpp5d UTSW 1 87,645,788 (GRCm39) missense probably benign 0.02
R5875:Inpp5d UTSW 1 87,645,696 (GRCm39) missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87,548,119 (GRCm39) splice site probably null
R6385:Inpp5d UTSW 1 87,627,397 (GRCm39) missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87,627,397 (GRCm39) missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87,603,972 (GRCm39) start gained probably benign
R6572:Inpp5d UTSW 1 87,623,118 (GRCm39) missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87,629,198 (GRCm39) nonsense probably null
R6853:Inpp5d UTSW 1 87,609,402 (GRCm39) splice site probably null
R6883:Inpp5d UTSW 1 87,627,412 (GRCm39) missense probably damaging 0.98
R7082:Inpp5d UTSW 1 87,623,102 (GRCm39) missense probably damaging 0.99
R7215:Inpp5d UTSW 1 87,628,940 (GRCm39) missense probably benign 0.30
R7418:Inpp5d UTSW 1 87,635,933 (GRCm39) critical splice donor site probably null
R7471:Inpp5d UTSW 1 87,623,122 (GRCm39) missense probably damaging 1.00
R7593:Inpp5d UTSW 1 87,645,500 (GRCm39) missense possibly damaging 0.82
R7716:Inpp5d UTSW 1 87,593,121 (GRCm39) missense probably damaging 0.97
R7781:Inpp5d UTSW 1 87,627,394 (GRCm39) missense probably damaging 1.00
R7808:Inpp5d UTSW 1 87,611,567 (GRCm39) nonsense probably null
R7920:Inpp5d UTSW 1 87,633,671 (GRCm39) missense probably damaging 1.00
R8788:Inpp5d UTSW 1 87,611,484 (GRCm39) missense probably damaging 1.00
R8839:Inpp5d UTSW 1 87,619,433 (GRCm39) missense probably damaging 0.97
R8905:Inpp5d UTSW 1 87,637,348 (GRCm39) missense probably damaging 0.99
R8906:Inpp5d UTSW 1 87,625,337 (GRCm39) intron probably benign
R9517:Inpp5d UTSW 1 87,638,853 (GRCm39) missense probably benign 0.01
R9667:Inpp5d UTSW 1 87,623,128 (GRCm39) missense probably damaging 1.00
R9716:Inpp5d UTSW 1 87,625,191 (GRCm39) missense possibly damaging 0.90
Z1176:Inpp5d UTSW 1 87,630,853 (GRCm39) missense probably damaging 1.00
Z1176:Inpp5d UTSW 1 87,597,431 (GRCm39) missense probably benign 0.16
Z1191:Inpp5d UTSW 1 87,611,492 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATGGGTAGATTCCTGCATGG -3'
(R):5'- TGATTTTCTGTCCACAGCCGAC -3'

Sequencing Primer
(F):5'- ATGGAATCTAGACTCTGTGTTCCCAG -3'
(R):5'- GACTCCTGAGAGCCTCTGTC -3'
Posted On 2018-04-27