Incidental Mutation 'R6156:Dock2'
ID489602
Institutional Source Beutler Lab
Gene Symbol Dock2
Ensembl Gene ENSMUSG00000020143
Gene Namededicator of cyto-kinesis 2
SynonymsCED-5, MBC, Hch
MMRRC Submission 044303-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6156 (G1)
Quality Score214.009
Status Validated
Chromosome11
Chromosomal Location34226815-34783892 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34247789 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 1484 (V1484F)
Ref Sequence ENSEMBL: ENSMUSP00000090884 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093193]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093193
AA Change: V1484F

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143
AA Change: V1484F

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.9%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the CDM protein family. It is specifically expressed in hematopoietic cells and is predominantly expressed in peripheral blood leukocytes. The protein is involved in remodeling of the actin cytoskeleton required for lymphocyte migration in response to chemokine signaling. It activates members of the Rho family of GTPases, for example RAC1 and RAC2, by acting as a guanine nucleotide exchange factor (GEF) to exchange bound GDP for free GTP. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 T G 15: 64,817,639 probably null Het
Ank2 T C 3: 126,944,237 D2579G probably damaging Het
Atp6v1b1 G C 6: 83,758,133 G423R probably damaging Het
B4galnt3 T C 6: 120,214,840 N644S probably benign Het
Capsl T G 15: 9,465,834 M132R probably damaging Het
Cep120 A G 18: 53,703,223 Y797H probably benign Het
Clec2e T A 6: 129,095,098 D106V possibly damaging Het
Col6a2 C T 10: 76,604,170 V634I possibly damaging Het
Dis3 T C 14: 99,098,779 E97G probably benign Het
Dlec1 T C 9: 119,110,213 probably null Het
Ephb2 T A 4: 136,661,505 M593L probably benign Het
Fcgrt T C 7: 45,102,060 T125A probably benign Het
Gabbr1 T C 17: 37,048,427 I98T probably benign Het
Gbp10 G A 5: 105,236,149 probably benign Het
Gfod1 T C 13: 43,201,038 S154G possibly damaging Het
Ggt5 C T 10: 75,609,326 T389I probably damaging Het
Gm5096 C A 18: 87,757,107 Y251* probably null Het
Got2 A G 8: 95,872,268 F169L probably benign Het
Gse1 A G 8: 120,489,127 K5E possibly damaging Het
Hyal5 T C 6: 24,891,438 I417T possibly damaging Het
Igkv4-91 G T 6: 68,768,623 T97K probably damaging Het
Il4i1 T C 7: 44,840,184 Y458H possibly damaging Het
Impg1 A T 9: 80,322,824 C740S probably damaging Het
Itgb1 C G 8: 128,732,054 T788R possibly damaging Het
Lman2l A G 1: 36,438,826 V143A probably damaging Het
Ltbp4 G T 7: 27,330,162 T136K unknown Het
Macf1 A G 4: 123,472,280 I1331T probably benign Het
Mmp11 G A 10: 75,926,491 A336V probably damaging Het
Myh2 A T 11: 67,181,053 I536F probably damaging Het
Myh4 A G 11: 67,250,792 M826V probably benign Het
Naca T C 10: 128,039,291 probably benign Het
Nr4a2 A G 2: 57,112,352 Y30H probably damaging Het
Olfr1200 T A 2: 88,767,590 I242L probably benign Het
Olfr1290 A T 2: 111,489,750 M136K probably damaging Het
Olfr1316 A T 2: 112,130,100 L237Q probably damaging Het
Olfr136 T A 17: 38,335,173 N5K probably damaging Het
Olfr1427 A G 19: 12,099,120 V173A possibly damaging Het
Olfr395 A T 11: 73,906,621 Y290* probably null Het
Olfr533 A G 7: 140,466,845 T215A probably benign Het
Olfr936 T A 9: 39,047,375 M15L possibly damaging Het
Paqr3 A C 5: 97,108,269 L82R probably damaging Het
Pex6 C T 17: 46,720,641 P456S probably benign Het
Pih1d2 A T 9: 50,621,152 K186I possibly damaging Het
Plekhh3 A G 11: 101,170,187 probably benign Het
Ptpn23 C A 9: 110,387,781 probably benign Het
Rcor3 T A 1: 192,127,842 probably benign Het
Rgs11 T A 17: 26,210,465 Y403* probably null Het
Scn10a T C 9: 119,635,583 N984D probably benign Het
Snx14 C T 9: 88,407,339 A287T possibly damaging Het
Stx3 T C 19: 11,803,510 D33G probably damaging Het
Tacc2 A G 7: 130,625,764 K1393R probably damaging Het
Tas2r129 T C 6: 132,951,492 S131P probably benign Het
Tbx15 G T 3: 99,313,115 probably null Het
Tex33 T C 15: 78,378,813 T214A probably damaging Het
Thada A G 17: 84,393,367 V1237A probably damaging Het
Tnc A G 4: 63,970,352 Y1735H probably damaging Het
Ttc22 A G 4: 106,638,583 K378R probably benign Het
Tubg2 A G 11: 101,160,809 K287E possibly damaging Het
Ugt3a1 T C 15: 9,310,676 I348T possibly damaging Het
Unc79 A G 12: 103,061,458 N436S probably damaging Het
Unc80 A T 1: 66,612,250 I1585F probably benign Het
Vmn2r104 T C 17: 20,041,647 Y407C probably damaging Het
Vmn2r108 T A 17: 20,472,185 L136F probably benign Het
Vmn2r38 A G 7: 9,094,612 S161P probably damaging Het
Vmn2r90 T C 17: 17,733,344 I590T probably benign Het
Washc5 T C 15: 59,345,399 E323G probably damaging Het
Wdhd1 C T 14: 47,268,196 G273D probably damaging Het
Xpo6 G T 7: 126,108,844 Q851K probably damaging Het
Zfp386 T C 12: 116,059,906 S380P probably damaging Het
Zfp536 A G 7: 37,473,856 C274R unknown Het
Zfp64 A G 2: 168,926,168 I508T probably benign Het
Other mutations in Dock2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Dock2 APN 11 34704661 missense probably damaging 1.00
IGL00469:Dock2 APN 11 34229603 splice site probably benign
IGL01061:Dock2 APN 11 34705826 missense probably damaging 1.00
IGL01319:Dock2 APN 11 34698790 missense possibly damaging 0.61
IGL01451:Dock2 APN 11 34310390 missense probably damaging 1.00
IGL01490:Dock2 APN 11 34705781 missense probably damaging 0.97
IGL01601:Dock2 APN 11 34239528 critical splice donor site probably null
IGL01800:Dock2 APN 11 34756273 missense probably damaging 1.00
IGL01804:Dock2 APN 11 34262433 missense probably benign 0.01
IGL01823:Dock2 APN 11 34262391 missense probably damaging 1.00
IGL01829:Dock2 APN 11 34705841 missense probably damaging 0.98
IGL01830:Dock2 APN 11 34691917 nonsense probably null
IGL01835:Dock2 APN 11 34310435 missense possibly damaging 0.51
IGL01845:Dock2 APN 11 34708865 missense probably benign 0.02
IGL01953:Dock2 APN 11 34732356 missense probably benign 0.28
IGL01989:Dock2 APN 11 34268053 missense probably benign
IGL02081:Dock2 APN 11 34254355 missense probably benign
IGL02105:Dock2 APN 11 34714525 missense probably damaging 1.00
IGL02153:Dock2 APN 11 34230670 missense probably benign 0.01
IGL02170:Dock2 APN 11 34267949 missense probably damaging 1.00
IGL02344:Dock2 APN 11 34731510 missense probably damaging 0.98
IGL02389:Dock2 APN 11 34698740 splice site probably benign
IGL02409:Dock2 APN 11 34501204 missense probably benign 0.00
IGL02472:Dock2 APN 11 34249801 missense probably benign 0.00
IGL02625:Dock2 APN 11 34501168 critical splice donor site probably null
IGL02929:Dock2 APN 11 34268048 missense probably damaging 1.00
IGL02951:Dock2 APN 11 34310448 unclassified probably benign
IGL02999:Dock2 APN 11 34692259 missense probably damaging 0.99
IGL03165:Dock2 APN 11 34687533 missense probably damaging 0.99
Arches UTSW 11 34689760 missense probably damaging 1.00
capitol_reef UTSW 11 34294170 critical splice acceptor site probably null
denali UTSW 11 34229472 critical splice donor site probably null
dew UTSW 11 34248636 nonsense probably null
Dry UTSW 11 34231652 missense possibly damaging 0.79
frazz UTSW 11 34248572 critical splice donor site probably benign
frizz UTSW 11 34258184 splice site probably benign
Harborside UTSW 11 34262445 missense probably benign
Landing UTSW 11 34714501 missense possibly damaging 0.83
latest UTSW 11 34756222 missense probably damaging 1.00
Launch UTSW 11 34256562 missense probably damaging 1.00
liaoning UTSW 11 34708793 missense probably damaging 1.00
midas UTSW 11 34294323 missense probably damaging 0.99
muelle UTSW 11 34687538 missense probably damaging 1.00
pier UTSW 11 34689766 missense probably damaging 1.00
plank UTSW 11 34783795 missense possibly damaging 0.51
riches UTSW 11 34688452 critical splice donor site probably null
skiff UTSW 11 34262388 missense probably null 0.80
Slip UTSW 11 34294286 missense probably benign 0.25
wassup UTSW 11 34503413 missense probably damaging 1.00
Wharf UTSW 11 34732371 missense possibly damaging 0.81
IGL03052:Dock2 UTSW 11 34232853 missense probably benign 0.01
PIT4377001:Dock2 UTSW 11 34721008 missense probably benign 0.02
R0006:Dock2 UTSW 11 34312453 unclassified probably benign
R0012:Dock2 UTSW 11 34783795 missense possibly damaging 0.51
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0063:Dock2 UTSW 11 34756284 critical splice acceptor site probably null
R0116:Dock2 UTSW 11 34688565 intron probably benign
R0149:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0361:Dock2 UTSW 11 34438327 missense probably damaging 1.00
R0462:Dock2 UTSW 11 34268052 missense possibly damaging 0.74
R0471:Dock2 UTSW 11 34688553 missense probably benign 0.30
R0538:Dock2 UTSW 11 34704718 splice site probably benign
R0543:Dock2 UTSW 11 34294325 missense probably damaging 1.00
R0660:Dock2 UTSW 11 34248621 missense probably damaging 1.00
R0676:Dock2 UTSW 11 34695236 missense probably damaging 0.99
R0722:Dock2 UTSW 11 34464970 splice site probably benign
R0801:Dock2 UTSW 11 34708793 missense probably damaging 1.00
R1110:Dock2 UTSW 11 34256535 missense possibly damaging 0.78
R1171:Dock2 UTSW 11 34695241 missense probably damaging 1.00
R1387:Dock2 UTSW 11 34273309 splice site probably benign
R1445:Dock2 UTSW 11 34239705 missense probably benign
R1494:Dock2 UTSW 11 34282761 nonsense probably null
R1589:Dock2 UTSW 11 34706461 missense probably damaging 0.99
R1597:Dock2 UTSW 11 34704647 missense probably benign 0.00
R1629:Dock2 UTSW 11 34262480 splice site probably null
R1749:Dock2 UTSW 11 34232767 critical splice donor site probably null
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1888:Dock2 UTSW 11 34707342 missense probably damaging 1.00
R1899:Dock2 UTSW 11 34294286 missense probably benign 0.25
R1924:Dock2 UTSW 11 34464934 missense possibly damaging 0.69
R2031:Dock2 UTSW 11 34727470 splice site probably benign
R2045:Dock2 UTSW 11 34294106 splice site probably null
R2098:Dock2 UTSW 11 34266279 missense probably benign 0.16
R2098:Dock2 UTSW 11 34719005 missense probably damaging 0.99
R2129:Dock2 UTSW 11 34727415 missense probably damaging 1.00
R2147:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2149:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2150:Dock2 UTSW 11 34229472 critical splice donor site probably null
R2176:Dock2 UTSW 11 34695217 missense probably benign 0.00
R2230:Dock2 UTSW 11 34294323 missense probably damaging 0.99
R2508:Dock2 UTSW 11 34312485 missense probably benign 0.04
R2875:Dock2 UTSW 11 34718885 missense probably damaging 1.00
R2885:Dock2 UTSW 11 34689766 missense probably damaging 1.00
R2910:Dock2 UTSW 11 34232910 splice site probably benign
R3081:Dock2 UTSW 11 34231610 missense probably benign
R3418:Dock2 UTSW 11 34689760 missense probably damaging 1.00
R3552:Dock2 UTSW 11 34720960 missense probably benign 0.22
R3731:Dock2 UTSW 11 34708895 missense probably damaging 1.00
R3846:Dock2 UTSW 11 34732371 missense possibly damaging 0.81
R4135:Dock2 UTSW 11 34714501 missense possibly damaging 0.83
R4598:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4599:Dock2 UTSW 11 34239536 missense probably damaging 1.00
R4715:Dock2 UTSW 11 34294118 missense probably damaging 1.00
R4722:Dock2 UTSW 11 34695471 missense probably damaging 1.00
R4742:Dock2 UTSW 11 34294170 critical splice acceptor site probably null
R4830:Dock2 UTSW 11 34273767 splice site probably null
R4884:Dock2 UTSW 11 34266248 missense probably damaging 1.00
R4990:Dock2 UTSW 11 34695251 missense probably damaging 1.00
R5334:Dock2 UTSW 11 34228643 missense probably benign 0.00
R5570:Dock2 UTSW 11 34727406 missense probably damaging 1.00
R5602:Dock2 UTSW 11 34254391 missense probably benign 0.16
R5681:Dock2 UTSW 11 34249836 missense probably benign 0.06
R5809:Dock2 UTSW 11 34262445 missense probably benign
R5860:Dock2 UTSW 11 34256562 missense probably damaging 1.00
R6111:Dock2 UTSW 11 34708787 missense probably damaging 0.99
R6155:Dock2 UTSW 11 34294123 missense probably benign 0.06
R6173:Dock2 UTSW 11 34262388 missense probably null 0.80
R6182:Dock2 UTSW 11 34229476 missense probably damaging 0.97
R6188:Dock2 UTSW 11 34503396 missense probably damaging 0.98
R6191:Dock2 UTSW 11 34231652 missense possibly damaging 0.79
R6283:Dock2 UTSW 11 34707325 missense probably damaging 0.99
R6395:Dock2 UTSW 11 34232874 missense probably damaging 1.00
R6465:Dock2 UTSW 11 34503413 missense probably damaging 1.00
R6500:Dock2 UTSW 11 34362822 missense possibly damaging 0.76
R6561:Dock2 UTSW 11 34687538 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705842 missense probably damaging 1.00
R6745:Dock2 UTSW 11 34705843 missense probably damaging 1.00
R6880:Dock2 UTSW 11 34688452 critical splice donor site probably null
R6913:Dock2 UTSW 11 34756222 missense probably damaging 1.00
R6997:Dock2 UTSW 11 34464922 missense probably damaging 1.00
R7057:Dock2 UTSW 11 34227684 missense probably benign 0.10
R7057:Dock2 UTSW 11 34695217 missense probably benign 0.00
R7134:Dock2 UTSW 11 34310363 missense probably benign 0.03
R7188:Dock2 UTSW 11 34239675 missense possibly damaging 0.87
R7239:Dock2 UTSW 11 34231677 missense probably benign 0.00
R7247:Dock2 UTSW 11 34714513 nonsense probably null
R7250:Dock2 UTSW 11 34695205 missense probably benign 0.01
R7250:Dock2 UTSW 11 34695293 missense probably damaging 1.00
R7271:Dock2 UTSW 11 34273750 missense possibly damaging 0.95
R7284:Dock2 UTSW 11 34230672 missense probably benign 0.01
X0017:Dock2 UTSW 11 34266271 missense probably benign 0.08
X0018:Dock2 UTSW 11 34232833 missense possibly damaging 0.65
X0058:Dock2 UTSW 11 34256564 missense probably damaging 1.00
X0066:Dock2 UTSW 11 34310357 missense possibly damaging 0.95
Z1088:Dock2 UTSW 11 34438300 missense probably benign 0.14
Z1088:Dock2 UTSW 11 34692382 missense probably damaging 1.00
Z1088:Dock2 UTSW 11 34695212 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGATTCCCTGGCAGCAG -3'
(R):5'- GAACTGACTCGGCCTAAGTC -3'

Sequencing Primer
(F):5'- AGATGCCCTGGTCACTGC -3'
(R):5'- CTGTTAAGAATTCCCCAGGGG -3'
Posted On2017-10-10