Mutagenetix > Incidental Mutation

Incidental Mutation 'R6115:Kif13a'

485094

Institutional Source

Beutler Lab

Gene Symbol

Kif13a

Ensembl Gene

ENSMUSG00000021375

Gene Name

kinesin family member 13A

Synonyms

4930505I07Rik, N-3 kinesin

MMRRC Submission

044264-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.264) question?

Stock #

R6115 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46902563-47083343 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 46954789 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 648 (I648F)

Ref Sequence

ENSEMBL: ENSMUSP00000153614 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000225591]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000056978
AA Change: I711F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: I711F

Domain	Start	End	E-Value	Type
KISc	3	360	2.69e-175	SMART
low complexity region	368	381	N/A	INTRINSIC
low complexity region	391	406	N/A	INTRINSIC
FHA	469	519	7.16e-2	SMART
coiled coil region	605	639	N/A	INTRINSIC
coiled coil region	664	704	N/A	INTRINSIC
Pfam:KIF1B	748	792	1.7e-19	PFAM
low complexity region	840	854	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
Pfam:DUF3694	1003	1270	2.2e-39	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1475	1492	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000225591
AA Change: I648F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Meta Mutation Damage Score

0.1311

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

98% (51/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	C	G	5: 64,055,317 (GRCm39)	Q18E	probably damaging	Het
Acsf3	T	A	8: 123,517,411 (GRCm39)	H402Q	probably damaging	Het
Adam34	T	G	8: 44,105,098 (GRCm39)	Q182H	probably benign	Het
Alx1	G	A	10: 102,864,304 (GRCm39)	P55L	possibly damaging	Het
Arhgef38	A	T	3: 132,838,374 (GRCm39)		probably null	Het
Ccdc102a	T	C	8: 95,629,999 (GRCm39)	N514S	probably benign	Het
Corin	T	A	5: 72,518,072 (GRCm39)	T317S	probably damaging	Het
Ctnna2	A	G	6: 77,613,822 (GRCm39)	V256A	probably benign	Het
Dhx29	A	T	13: 113,089,335 (GRCm39)		probably null	Het
Dnah2	C	A	11: 69,337,475 (GRCm39)	D3209Y	probably damaging	Het
Dnhd1	A	G	7: 105,363,194 (GRCm39)	T3919A	probably benign	Het
F7	T	A	8: 13,083,958 (GRCm39)	N214K	probably benign	Het
Fam3b	T	G	16: 97,276,568 (GRCm39)	Q177H	possibly damaging	Het
Fign	T	C	2: 63,809,654 (GRCm39)	I539V	probably benign	Het
Hc	T	G	2: 34,903,050 (GRCm39)	D1067A	probably damaging	Het
Herc6	A	G	6: 57,560,191 (GRCm39)	D77G	probably benign	Het
Hmg20a	A	T	9: 56,397,116 (GRCm39)	E305D	possibly damaging	Het
Il16	G	A	7: 83,301,775 (GRCm39)	Q116*	probably null	Het
Lactb	G	T	9: 66,874,969 (GRCm39)	N374K	possibly damaging	Het
Lmx1b	T	C	2: 33,459,118 (GRCm39)	D145G	probably damaging	Het
Lrfn4	T	C	19: 4,663,937 (GRCm39)	D199G	probably damaging	Het
Lrrc49	A	T	9: 60,522,444 (GRCm39)	V307E	possibly damaging	Het
Magi1	A	C	6: 93,685,051 (GRCm39)	S776A	possibly damaging	Het
Mthfsl	T	A	9: 88,570,807 (GRCm39)	*147L	probably null	Het
Nsmce4a	G	T	7: 130,148,722 (GRCm39)	Q95K	probably benign	Het
Or1j15	A	T	2: 36,458,963 (GRCm39)	M118L	probably damaging	Het
Or4k37	A	G	2: 111,159,558 (GRCm39)	T265A	probably benign	Het
Or4k49	A	T	2: 111,494,987 (GRCm39)	K139*	probably null	Het
Or5b24	T	C	19: 12,912,948 (GRCm39)	V282A	possibly damaging	Het
Pcdha7	A	G	18: 37,107,788 (GRCm39)	E271G	probably damaging	Het
Pcdhga8	T	A	18: 37,860,596 (GRCm39)	F551I	possibly damaging	Het
Prpf31	T	C	7: 3,642,705 (GRCm39)		probably null	Het
Qrfpr	C	T	3: 36,236,742 (GRCm39)	V220I	possibly damaging	Het
Rnf170	T	C	8: 26,615,994 (GRCm39)	F95S	possibly damaging	Het
Scn9a	T	A	2: 66,393,973 (GRCm39)	Y200F	possibly damaging	Het
Sfpq	A	T	4: 126,915,141 (GRCm39)		probably null	Het
Slc9c1	A	T	16: 45,376,132 (GRCm39)	Y406F	probably damaging	Het
Stk32c	G	T	7: 138,700,628 (GRCm39)	Y200*	probably null	Het
Svil	A	G	18: 5,108,675 (GRCm39)	R1938G	probably damaging	Het
Sycp2	G	C	2: 177,990,038 (GRCm39)	R1403G	probably benign	Het
Tm9sf4	T	C	2: 153,024,409 (GRCm39)		probably null	Het
Tmc3	A	T	7: 83,264,170 (GRCm39)	M633L	possibly damaging	Het
Tmem163	T	C	1: 127,605,185 (GRCm39)	D61G	possibly damaging	Het
Unc5b	C	A	10: 60,613,325 (GRCm39)	A304S	probably benign	Het
Vmn2r106	G	A	17: 20,488,638 (GRCm39)	P587L	probably benign	Het
Vmn2r18	A	T	5: 151,508,462 (GRCm39)	S221T	possibly damaging	Het
Vmn2r85	T	G	10: 130,258,672 (GRCm39)	Y461S	probably damaging	Het
Yod1	T	C	1: 130,646,800 (GRCm39)	F226L	possibly damaging	Het
Zbtb4	T	C	11: 69,667,148 (GRCm39)	I151T	probably damaging	Het
Zfp110	A	T	7: 12,583,701 (GRCm39)	Q783L	probably damaging	Het

Other mutations in Kif13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Kif13a	APN	13	46,904,110 (GRCm39)	splice site	probably benign
IGL01433:Kif13a	APN	13	46,926,384 (GRCm39)	missense	probably damaging	1.00
IGL01528:Kif13a	APN	13	47,018,313 (GRCm39)	splice site	probably benign
IGL01536:Kif13a	APN	13	46,905,765 (GRCm39)	missense	probably damaging	0.96
IGL01620:Kif13a	APN	13	47,018,296 (GRCm39)	missense	probably benign
IGL02020:Kif13a	APN	13	46,947,495 (GRCm39)	missense	probably benign	0.05
IGL02142:Kif13a	APN	13	46,925,011 (GRCm39)	missense	probably benign	0.04
IGL02375:Kif13a	APN	13	46,978,698 (GRCm39)	missense	probably damaging	1.00
IGL02407:Kif13a	APN	13	46,938,769 (GRCm39)	missense	probably damaging	0.99
IGL02476:Kif13a	APN	13	46,938,772 (GRCm39)	missense	probably damaging	1.00
IGL03038:Kif13a	APN	13	46,926,314 (GRCm39)	missense	probably damaging	1.00
IGL03053:Kif13a	APN	13	46,905,564 (GRCm39)	missense	probably benign	0.01
IGL03366:Kif13a	APN	13	46,918,099 (GRCm39)	missense	probably benign	0.00
R0025:Kif13a	UTSW	13	46,939,987 (GRCm39)	critical splice donor site	probably null
R0106:Kif13a	UTSW	13	46,978,823 (GRCm39)	splice site	probably benign
R0106:Kif13a	UTSW	13	46,978,823 (GRCm39)	splice site	probably benign
R0135:Kif13a	UTSW	13	46,947,419 (GRCm39)	missense	probably damaging	0.99
R0137:Kif13a	UTSW	13	46,918,079 (GRCm39)	missense	probably benign	0.38
R0243:Kif13a	UTSW	13	46,944,827 (GRCm39)	missense	probably benign	0.24
R0346:Kif13a	UTSW	13	46,967,695 (GRCm39)	missense	possibly damaging	0.95
R0403:Kif13a	UTSW	13	46,944,877 (GRCm39)	missense	probably damaging	1.00
R0492:Kif13a	UTSW	13	46,966,218 (GRCm39)	missense	possibly damaging	0.93
R0607:Kif13a	UTSW	13	46,956,187 (GRCm39)	missense	probably damaging	0.96
R0631:Kif13a	UTSW	13	46,932,364 (GRCm39)	unclassified	probably benign
R0654:Kif13a	UTSW	13	46,966,218 (GRCm39)	missense	possibly damaging	0.93
R0697:Kif13a	UTSW	13	47,001,813 (GRCm39)	missense	probably benign	0.19
R0699:Kif13a	UTSW	13	46,952,689 (GRCm39)	missense	possibly damaging	0.92
R0715:Kif13a	UTSW	13	46,966,299 (GRCm39)	missense	probably damaging	0.98
R0834:Kif13a	UTSW	13	46,967,712 (GRCm39)	missense	probably damaging	0.96
R0903:Kif13a	UTSW	13	47,082,735 (GRCm39)	missense	possibly damaging	0.75
R1419:Kif13a	UTSW	13	46,978,711 (GRCm39)	missense	probably damaging	1.00
R1428:Kif13a	UTSW	13	46,944,987 (GRCm39)	splice site	probably benign
R1449:Kif13a	UTSW	13	46,966,212 (GRCm39)	missense	probably damaging	1.00
R1463:Kif13a	UTSW	13	47,083,088 (GRCm39)	missense	possibly damaging	0.75
R1541:Kif13a	UTSW	13	46,962,689 (GRCm39)	missense	probably benign
R1579:Kif13a	UTSW	13	46,906,332 (GRCm39)	missense	possibly damaging	0.93
R1582:Kif13a	UTSW	13	46,947,398 (GRCm39)	missense	probably benign	0.03
R1644:Kif13a	UTSW	13	46,947,398 (GRCm39)	missense	probably benign	0.31
R1752:Kif13a	UTSW	13	46,951,885 (GRCm39)	missense	probably damaging	1.00
R1755:Kif13a	UTSW	13	46,927,154 (GRCm39)	missense	possibly damaging	0.50
R1755:Kif13a	UTSW	13	46,906,089 (GRCm39)	missense	possibly damaging	0.73
R1858:Kif13a	UTSW	13	47,018,314 (GRCm39)	splice site	probably benign
R1891:Kif13a	UTSW	13	47,082,695 (GRCm39)	missense	possibly damaging	0.63
R1902:Kif13a	UTSW	13	46,941,638 (GRCm39)	missense	probably benign	0.00
R1928:Kif13a	UTSW	13	46,966,221 (GRCm39)	missense	probably damaging	1.00
R1960:Kif13a	UTSW	13	47,018,314 (GRCm39)	splice site	probably benign
R1961:Kif13a	UTSW	13	47,018,314 (GRCm39)	splice site	probably benign
R2016:Kif13a	UTSW	13	46,964,275 (GRCm39)	missense	probably benign	0.13
R2139:Kif13a	UTSW	13	46,905,945 (GRCm39)	missense	possibly damaging	0.92
R2174:Kif13a	UTSW	13	46,922,652 (GRCm39)	missense	probably damaging	0.99
R2407:Kif13a	UTSW	13	46,930,573 (GRCm39)	missense	probably damaging	1.00
R2504:Kif13a	UTSW	13	46,967,676 (GRCm39)	missense	probably damaging	1.00
R3122:Kif13a	UTSW	13	46,918,072 (GRCm39)	splice site	probably benign
R3499:Kif13a	UTSW	13	46,978,815 (GRCm39)	missense	probably damaging	1.00
R3905:Kif13a	UTSW	13	46,956,166 (GRCm39)	missense	probably damaging	1.00
R4474:Kif13a	UTSW	13	46,967,631 (GRCm39)	splice site	probably null
R4771:Kif13a	UTSW	13	46,978,687 (GRCm39)	missense	probably damaging	1.00
R4838:Kif13a	UTSW	13	46,980,224 (GRCm39)	missense	probably damaging	1.00
R4924:Kif13a	UTSW	13	47,083,075 (GRCm39)	missense	probably damaging	1.00
R4931:Kif13a	UTSW	13	46,962,531 (GRCm39)	missense	probably damaging	0.96
R4980:Kif13a	UTSW	13	46,906,222 (GRCm39)	missense	possibly damaging	0.76
R4992:Kif13a	UTSW	13	46,930,639 (GRCm39)	missense	probably damaging	0.96
R5047:Kif13a	UTSW	13	46,941,561 (GRCm39)	missense	probably benign	0.00
R5054:Kif13a	UTSW	13	46,956,122 (GRCm39)	missense	probably damaging	1.00
R5141:Kif13a	UTSW	13	46,906,197 (GRCm39)	missense	probably benign
R5329:Kif13a	UTSW	13	46,928,877 (GRCm39)	critical splice donor site	probably null
R5429:Kif13a	UTSW	13	46,926,245 (GRCm39)	critical splice donor site	probably null
R5499:Kif13a	UTSW	13	46,986,212 (GRCm39)	missense	probably damaging	1.00
R5509:Kif13a	UTSW	13	46,905,591 (GRCm39)	missense	probably benign	0.13
R5594:Kif13a	UTSW	13	46,906,338 (GRCm39)	missense	probably damaging	1.00
R5921:Kif13a	UTSW	13	46,978,776 (GRCm39)	missense	probably damaging	1.00
R5964:Kif13a	UTSW	13	46,925,000 (GRCm39)	missense	probably damaging	1.00
R6317:Kif13a	UTSW	13	46,980,233 (GRCm39)	missense	probably damaging	1.00
R6318:Kif13a	UTSW	13	46,968,683 (GRCm39)	splice site	probably null
R6393:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R6394:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R6395:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R6735:Kif13a	UTSW	13	46,906,222 (GRCm39)	missense	possibly damaging	0.76
R7037:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7038:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7039:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7237:Kif13a	UTSW	13	46,962,632 (GRCm39)	critical splice donor site	probably null
R7285:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7286:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7287:Kif13a	UTSW	13	46,905,931 (GRCm39)	missense	possibly damaging	0.95
R7341:Kif13a	UTSW	13	46,980,221 (GRCm39)	missense	probably damaging	1.00
R7693:Kif13a	UTSW	13	46,904,089 (GRCm39)	missense	probably benign	0.01
R7761:Kif13a	UTSW	13	46,951,955 (GRCm39)	missense	probably benign
R8098:Kif13a	UTSW	13	46,968,780 (GRCm39)	missense	probably damaging	1.00
R8171:Kif13a	UTSW	13	46,932,444 (GRCm39)	missense	probably damaging	1.00
R8271:Kif13a	UTSW	13	46,906,057 (GRCm39)	missense	probably benign	0.01
R8806:Kif13a	UTSW	13	46,914,813 (GRCm39)	missense	possibly damaging	0.49
R8871:Kif13a	UTSW	13	46,984,279 (GRCm39)	missense	probably damaging	1.00
R8877:Kif13a	UTSW	13	46,954,921 (GRCm39)	critical splice acceptor site	probably null
R8906:Kif13a	UTSW	13	46,927,154 (GRCm39)	missense	probably benign	0.17
R9028:Kif13a	UTSW	13	46,951,841 (GRCm39)	missense	probably damaging	1.00
R9058:Kif13a	UTSW	13	46,944,941 (GRCm39)	missense	probably damaging	1.00
R9062:Kif13a	UTSW	13	46,941,536 (GRCm39)	missense	possibly damaging	0.91
R9070:Kif13a	UTSW	13	46,905,934 (GRCm39)	missense	probably benign	0.00
R9083:Kif13a	UTSW	13	46,966,263 (GRCm39)	missense	probably damaging	1.00
R9250:Kif13a	UTSW	13	46,928,909 (GRCm39)	missense	probably damaging	1.00
R9328:Kif13a	UTSW	13	46,951,838 (GRCm39)	missense	probably damaging	1.00
R9360:Kif13a	UTSW	13	46,962,472 (GRCm39)	missense	probably benign	0.01
R9369:Kif13a	UTSW	13	46,940,099 (GRCm39)	missense	probably damaging	0.99
R9589:Kif13a	UTSW	13	46,956,020 (GRCm39)	missense	probably benign	0.01
R9749:Kif13a	UTSW	13	46,914,227 (GRCm39)	missense	probably damaging	0.96
X0013:Kif13a	UTSW	13	47,082,746 (GRCm39)	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- CCCAGTATGCTTACCCATGG -3'
(R):5'- GTTACCGTTTCCTGGCAGTC -3'

Sequencing Primer
(F):5'- GGTAAATACCAACCCCCGC -3'
(R):5'- AGTCCCGCACGCTGAGAAAG -3'

Posted On

2017-08-16