Mutagenetix > Incidental Mutation

Incidental Mutation 'Z31818:Rag2'

478393

Institutional Source

Beutler Lab

Gene Symbol

Rag2

Ensembl Gene

ENSMUSG00000032864

Gene Name

recombination activating gene 2

Synonyms

Rag-2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

Z31818 (F1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

101455063-101462874 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 101461150 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 487 (A487T)

Ref Sequence

ENSEMBL: ENSMUSP00000106858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044031] [ENSMUST00000099682] [ENSMUST00000111227] [ENSMUST00000111231] [ENSMUST00000128898] [ENSMUST00000160037] [ENSMUST00000160722]

AlphaFold

P21784

Predicted Effect

probably damaging
Transcript: ENSMUST00000044031
AA Change: A487T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000038204
Gene: ENSMUSG00000032864
AA Change: A487T

Domain	Start	End	E-Value	Type
Pfam:RAG2	51	389	3.5e-179	PFAM
Pfam:RAG2_PHD	414	491	7.2e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000099682

Predicted Effect

probably damaging
Transcript: ENSMUST00000111227
AA Change: A487T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106858
Gene: ENSMUSG00000032864
AA Change: A487T

Domain	Start	End	E-Value	Type
Pfam:RAG2	51	389	6.7e-193	PFAM
Pfam:RAG2_PHD	414	491	1.1e-50	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000111231

Predicted Effect

probably benign
Transcript: ENSMUST00000128898

Predicted Effect

probably benign
Transcript: ENSMUST00000160037

Predicted Effect

probably benign
Transcript: ENSMUST00000160722

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177007

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000177171

Coding Region Coverage

1x: 99.8%
3x: 99.4%
10x: 96.9%
20x: 89.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in the initiation of V(D)J recombination during B and T cell development. This protein forms a complex with the product of the adjacent recombination activating gene 1, and this complex can form double-strand breaks by cleaving DNA at conserved recombination signal sequences. The recombination activating gene 1 component is thought to contain most of the catalytic activity, while the N-terminal of the recombination activating gene 2 component is thought to form a six-bladed propeller in the active core that serves as a binding scaffold for the tight association of the complex with DNA. A C-terminal plant homeodomain finger-like motif in this protein is necessary for interactions with chromatin components, specifically with histone H3 that is trimethylated at lysine 4. Mutations in this gene cause Omenn syndrome, a form of severe combined immunodeficiency associated with autoimmune-like symptoms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]

Allele List at MGI

All alleles(14) : Targeted(14)

Other mutations in this stock

Total: 14 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Dmrtc2	C	A	7: 24,576,583 (GRCm39)	P336T	probably benign	Het
Flt3	C	T	5: 147,303,728 (GRCm39)		probably null	Het
Fndc5	G	A	4: 129,033,142 (GRCm39)	D70N	probably damaging	Het
Gan	T	A	8: 117,922,536 (GRCm39)	I423N	probably damaging	Het
Itpr3	T	G	17: 27,314,452 (GRCm39)	L634R	probably damaging	Het
Ndufb5	T	A	3: 32,800,610 (GRCm39)	M74K	probably benign	Het
Or9m1b	A	T	2: 87,836,234 (GRCm39)	L287*	probably null	Het
Osbpl6	A	G	2: 76,385,426 (GRCm39)	R287G	probably damaging	Het
Pkd1l3	A	C	8: 110,395,924 (GRCm39)	N2098T	probably damaging	Het
Proser3	G	A	7: 30,245,790 (GRCm39)	P97L	possibly damaging	Het
Sorl1	A	T	9: 41,952,892 (GRCm39)	C716*	probably null	Het
Ugt1a6b	T	C	1: 88,034,877 (GRCm39)	Y72H	probably benign	Het
Vmn2r74	T	C	7: 85,604,729 (GRCm39)		probably null	Het
Vps13a	C	T	19: 16,758,118 (GRCm39)	V6M	possibly damaging	Het

Other mutations in Rag2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00647:Rag2	APN	2	101,460,962 (GRCm39)	missense	probably benign	0.00
IGL01358:Rag2	APN	2	101,460,365 (GRCm39)	missense	possibly damaging	0.95
IGL01774:Rag2	APN	2	101,460,392 (GRCm39)	missense	probably damaging	1.00
IGL02267:Rag2	APN	2	101,460,376 (GRCm39)	missense	probably damaging	1.00
IGL02507:Rag2	APN	2	101,461,055 (GRCm39)	missense	probably damaging	0.99
IGL02615:Rag2	APN	2	101,459,913 (GRCm39)	nonsense	probably null
IGL02690:Rag2	APN	2	101,459,839 (GRCm39)	missense	probably benign	0.00
IGL03087:Rag2	APN	2	101,460,559 (GRCm39)	missense	probably benign	0.00
IGL03261:Rag2	APN	2	101,460,608 (GRCm39)	missense	probably damaging	0.96
billfold	UTSW	2	101,461,118 (GRCm39)	missense	probably damaging	1.00
Brag	UTSW	2	101,460,040 (GRCm39)	missense	probably damaging	1.00
excambiar	UTSW	2	101,461,121 (GRCm39)	missense	probably damaging	0.99
picker	UTSW	2	101,460,419 (GRCm39)	missense	probably damaging	1.00
snowcock	UTSW	2	101,460,948 (GRCm39)	missense	probably damaging	1.00
woodcock	UTSW	2	101,460,464 (GRCm39)	missense	probably damaging	0.98
R0266:Rag2	UTSW	2	101,460,948 (GRCm39)	missense	probably damaging	1.00
R0284:Rag2	UTSW	2	101,460,464 (GRCm39)	missense	probably damaging	0.98
R1250:Rag2	UTSW	2	101,460,784 (GRCm39)	missense	probably damaging	0.96
R1520:Rag2	UTSW	2	101,460,476 (GRCm39)	missense	probably damaging	0.99
R1641:Rag2	UTSW	2	101,459,960 (GRCm39)	missense	probably benign	0.22
R2260:Rag2	UTSW	2	101,460,583 (GRCm39)	missense	probably benign	0.00
R2571:Rag2	UTSW	2	101,460,312 (GRCm39)	missense	probably damaging	0.99
R3441:Rag2	UTSW	2	101,460,645 (GRCm39)	missense	probably damaging	0.99
R3752:Rag2	UTSW	2	101,461,121 (GRCm39)	missense	probably damaging	0.99
R4894:Rag2	UTSW	2	101,460,022 (GRCm39)	missense	probably damaging	1.00
R5197:Rag2	UTSW	2	101,461,085 (GRCm39)	missense	probably damaging	1.00
R5236:Rag2	UTSW	2	101,460,005 (GRCm39)	missense	probably damaging	1.00
R6815:Rag2	UTSW	2	101,460,900 (GRCm39)	missense	probably damaging	0.99
R7365:Rag2	UTSW	2	101,461,118 (GRCm39)	missense	probably damaging	1.00
R7917:Rag2	UTSW	2	101,460,040 (GRCm39)	missense	probably damaging	1.00
R9026:Rag2	UTSW	2	101,460,494 (GRCm39)	missense	possibly damaging	0.46
R9243:Rag2	UTSW	2	101,460,419 (GRCm39)	missense	probably damaging	1.00
R9280:Rag2	UTSW	2	101,460,145 (GRCm39)	missense	probably benign	0.05
R9333:Rag2	UTSW	2	101,460,752 (GRCm39)	missense	probably benign	0.01
R9500:Rag2	UTSW	2	101,461,217 (GRCm39)	missense	probably damaging	1.00
X0027:Rag2	UTSW	2	101,460,718 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAATACCTGGGTTCCGTTC -3'
(R):5'- CAGCAGTAGTGTGGGATATAGCTG -3'

Sequencing Primer
(F):5'- TTCTATTCAACGGAGCTCAATAAACC -3'
(R):5'- ACATTTCTCATTTAAGACATTCCTGG -3'

Posted On

2017-06-26