Incidental Mutation 'R5649:Reln'
ID 441312
Institutional Source Beutler Lab
Gene Symbol Reln
Ensembl Gene ENSMUSG00000042453
Gene Name reelin
Synonyms
MMRRC Submission 043170-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.951) question?
Stock # R5649 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 22089452-22549700 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 22106623 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 3249 (I3249T)
Ref Sequence ENSEMBL: ENSMUSP00000124052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062372] [ENSMUST00000161356]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062372
AA Change: I3249T

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000058025
Gene: ENSMUSG00000042453
AA Change: I3249T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 40 172 6.1e-24 PFAM
internal_repeat_3 195 360 5.04e-6 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3450 3457 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159768
Predicted Effect probably benign
Transcript: ENSMUST00000161356
AA Change: I3249T

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124052
Gene: ENSMUSG00000042453
AA Change: I3249T

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Reeler 54 171 2.9e-10 PFAM
internal_repeat_3 195 360 5.06e-6 PROSPERO
internal_repeat_2 207 413 3.41e-11 PROSPERO
EGF 674 702 1.2e1 SMART
EGF_like 1033 1061 6.95e1 SMART
EGF 1412 1442 6.02e0 SMART
internal_repeat_2 1452 1660 3.41e-11 PROSPERO
EGF_like 1768 1796 2.92e1 SMART
low complexity region 1939 1948 N/A INTRINSIC
low complexity region 2062 2071 N/A INTRINSIC
EGF 2132 2161 1.43e-1 SMART
EGF_like 2481 2509 3.43e1 SMART
EGF 2856 2884 2.2e1 SMART
EGF 3231 3260 3.46e0 SMART
low complexity region 3452 3459 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200667
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 96.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large secreted extracellular matrix protein thought to control cell-cell interactions critical for cell positioning and neuronal migration during brain development. This protein may be involved in schizophrenia, autism, bipolar disorder, major depression and in migration defects associated with temporal lobe epilepsy. Mutations of this gene are associated with autosomal recessive lissencephaly with cerebellar hypoplasia. Two transcript variants encoding distinct isoforms have been identified for this gene. Other transcript variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for most spontaneous or ENU-induced mutations show impaired righting responses, ataxia, tremors, and cerebellum and hippocampus abnormalities. Some mutants show postnatal or premature death and decreased body size while others have abnormal retinas or olfactory bulbs or infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,330,501 (GRCm39) T1385A probably damaging Het
Apc2 T A 10: 80,149,972 (GRCm39) D1646E probably damaging Het
Aspm G A 1: 139,407,407 (GRCm39) R2098H probably benign Het
Atl3 C A 19: 7,509,592 (GRCm39) T435N possibly damaging Het
Cdh22 G T 2: 164,958,200 (GRCm39) T589K probably damaging Het
Cnot3 T C 7: 3,661,082 (GRCm39) L561S probably benign Het
Col5a1 A G 2: 27,841,468 (GRCm39) D363G unknown Het
Cyp24a1 T C 2: 170,338,229 (GRCm39) D105G possibly damaging Het
Dennd4a C A 9: 64,758,491 (GRCm39) probably null Het
Dnah8 A G 17: 31,019,561 (GRCm39) K3878R probably benign Het
Dock4 T C 12: 40,894,539 (GRCm39) S1900P probably benign Het
Fancg A G 4: 43,008,736 (GRCm39) L167P probably damaging Het
Ighd2-8 A G 12: 113,414,487 (GRCm39) S1P possibly damaging Het
Kif28 A G 1: 179,525,336 (GRCm39) probably null Het
Mrpl55 T A 11: 59,095,397 (GRCm39) C20* probably null Het
Myo5a A G 9: 75,079,001 (GRCm39) K920E possibly damaging Het
Naa35 G A 13: 59,770,680 (GRCm39) probably benign Het
Olfm3 A G 3: 114,890,573 (GRCm39) R76G probably damaging Het
Or14a258 T C 7: 86,035,521 (GRCm39) M116V probably damaging Het
Or2ag1 T C 7: 106,313,373 (GRCm39) R172G possibly damaging Het
Pcdha12 A T 18: 37,155,468 (GRCm39) D729V probably benign Het
Phf11c T C 14: 59,622,981 (GRCm39) probably null Het
Phf20 T A 2: 156,093,688 (GRCm39) probably null Het
Plbd1 T A 6: 136,593,987 (GRCm39) Y376F probably benign Het
Poglut1 A G 16: 38,352,173 (GRCm39) V257A probably damaging Het
Rgsl1 G A 1: 153,701,639 (GRCm39) P272S possibly damaging Het
Slc15a2 A T 16: 36,592,472 (GRCm39) Y197* probably null Het
Slc45a2 C T 15: 11,012,693 (GRCm39) T232I probably benign Het
Ssc5d T A 7: 4,929,517 (GRCm39) probably null Het
Thbs2 T C 17: 14,910,215 (GRCm39) Y128C probably damaging Het
Them4 A T 3: 94,238,851 (GRCm39) L219F possibly damaging Het
Tmem30b G T 12: 73,592,940 (GRCm39) N58K probably benign Het
Trappc2b T C 11: 51,576,799 (GRCm39) E33G probably benign Het
Ttc29 G A 8: 78,972,942 (GRCm39) E131K possibly damaging Het
Vmn1r29 C G 6: 58,284,676 (GRCm39) S132C probably benign Het
Vmn1r53 G A 6: 90,200,742 (GRCm39) A194V probably benign Het
Wdr86 A T 5: 24,923,085 (GRCm39) H202Q probably benign Het
Xirp2 A G 2: 67,347,239 (GRCm39) D3160G probably benign Het
Xkr5 T C 8: 18,983,982 (GRCm39) D520G probably benign Het
Zfp607b T G 7: 27,403,406 (GRCm39) C621G probably damaging Het
Other mutations in Reln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL00091:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL00432:Reln APN 5 22,215,125 (GRCm39) missense probably damaging 1.00
IGL00433:Reln APN 5 22,250,007 (GRCm39) missense probably damaging 1.00
IGL00576:Reln APN 5 22,359,948 (GRCm39) missense probably benign 0.01
IGL00755:Reln APN 5 22,265,378 (GRCm39) missense probably damaging 0.98
IGL00777:Reln APN 5 22,223,848 (GRCm39) critical splice donor site probably null
IGL00900:Reln APN 5 22,185,115 (GRCm39) missense probably damaging 0.98
IGL01067:Reln APN 5 22,184,664 (GRCm39) missense probably damaging 1.00
IGL01104:Reln APN 5 22,191,965 (GRCm39) missense probably damaging 0.99
IGL01141:Reln APN 5 22,174,031 (GRCm39) missense probably damaging 1.00
IGL01141:Reln APN 5 22,124,067 (GRCm39) missense probably damaging 1.00
IGL01333:Reln APN 5 22,376,249 (GRCm39) missense probably damaging 0.99
IGL01341:Reln APN 5 22,174,077 (GRCm39) missense probably damaging 1.00
IGL01354:Reln APN 5 22,124,173 (GRCm39) nonsense probably null
IGL01361:Reln APN 5 22,124,019 (GRCm39) missense probably benign 0.06
IGL01446:Reln APN 5 22,174,315 (GRCm39) missense probably damaging 0.99
IGL01448:Reln APN 5 22,245,403 (GRCm39) missense probably benign 0.40
IGL01612:Reln APN 5 22,101,928 (GRCm39) missense probably damaging 0.99
IGL01695:Reln APN 5 22,125,436 (GRCm39) missense probably damaging 1.00
IGL01718:Reln APN 5 22,152,512 (GRCm39) missense possibly damaging 0.60
IGL01749:Reln APN 5 22,549,244 (GRCm39) nonsense probably null
IGL01875:Reln APN 5 22,109,715 (GRCm39) missense probably benign
IGL02013:Reln APN 5 22,155,877 (GRCm39) missense probably damaging 1.00
IGL02031:Reln APN 5 22,184,014 (GRCm39) missense probably damaging 0.99
IGL02186:Reln APN 5 22,114,956 (GRCm39) missense probably damaging 1.00
IGL02228:Reln APN 5 22,109,729 (GRCm39) missense probably damaging 0.99
IGL02248:Reln APN 5 22,115,990 (GRCm39) missense probably damaging 1.00
IGL02336:Reln APN 5 22,134,132 (GRCm39) missense probably damaging 1.00
IGL02352:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL02359:Reln APN 5 22,244,563 (GRCm39) missense possibly damaging 0.57
IGL02376:Reln APN 5 22,285,789 (GRCm39) nonsense probably null
IGL02408:Reln APN 5 22,106,617 (GRCm39) missense probably benign 0.44
IGL02415:Reln APN 5 22,176,949 (GRCm39) missense possibly damaging 0.91
IGL02512:Reln APN 5 22,245,425 (GRCm39) missense probably benign 0.00
IGL02540:Reln APN 5 22,239,750 (GRCm39) missense probably damaging 0.96
IGL02624:Reln APN 5 22,308,355 (GRCm39) missense probably benign 0.09
IGL02720:Reln APN 5 22,202,939 (GRCm39) missense probably damaging 0.99
IGL02894:Reln APN 5 22,090,546 (GRCm39) missense possibly damaging 0.72
IGL02999:Reln APN 5 22,200,363 (GRCm39) missense probably damaging 1.00
IGL03125:Reln APN 5 22,115,842 (GRCm39) missense probably damaging 1.00
IGL03298:Reln APN 5 22,115,834 (GRCm39) missense probably damaging 0.99
Fishing UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
P0020:Reln UTSW 5 22,311,058 (GRCm39) missense possibly damaging 0.91
PIT4151001:Reln UTSW 5 22,491,894 (GRCm39) missense possibly damaging 0.71
R0018:Reln UTSW 5 22,130,369 (GRCm39) missense probably benign 0.01
R0105:Reln UTSW 5 22,253,813 (GRCm39) missense probably damaging 0.99
R0105:Reln UTSW 5 22,253,813 (GRCm39) missense probably damaging 0.99
R0127:Reln UTSW 5 22,209,134 (GRCm39) missense probably damaging 1.00
R0135:Reln UTSW 5 22,333,647 (GRCm39) missense probably damaging 0.99
R0144:Reln UTSW 5 22,153,447 (GRCm39) missense probably damaging 0.97
R0240:Reln UTSW 5 22,311,043 (GRCm39) missense probably benign 0.36
R0240:Reln UTSW 5 22,311,043 (GRCm39) missense probably benign 0.36
R0242:Reln UTSW 5 22,147,595 (GRCm39) critical splice donor site probably null
R0242:Reln UTSW 5 22,147,595 (GRCm39) critical splice donor site probably null
R0266:Reln UTSW 5 22,193,774 (GRCm39) missense probably damaging 1.00
R0269:Reln UTSW 5 22,125,535 (GRCm39) missense probably damaging 1.00
R0280:Reln UTSW 5 22,432,511 (GRCm39) splice site probably benign
R0333:Reln UTSW 5 22,134,240 (GRCm39) missense probably damaging 0.97
R0357:Reln UTSW 5 22,155,820 (GRCm39) missense probably damaging 1.00
R0359:Reln UTSW 5 22,253,798 (GRCm39) missense probably damaging 0.98
R0506:Reln UTSW 5 22,125,494 (GRCm39) missense probably damaging 0.97
R0534:Reln UTSW 5 22,152,406 (GRCm39) missense probably damaging 0.99
R0535:Reln UTSW 5 22,256,274 (GRCm39) splice site probably benign
R0541:Reln UTSW 5 22,185,107 (GRCm39) missense possibly damaging 0.88
R0615:Reln UTSW 5 22,215,148 (GRCm39) missense probably benign 0.36
R0617:Reln UTSW 5 22,125,535 (GRCm39) missense probably damaging 1.00
R0634:Reln UTSW 5 22,223,867 (GRCm39) missense probably damaging 1.00
R0653:Reln UTSW 5 22,118,228 (GRCm39) missense probably benign 0.44
R0704:Reln UTSW 5 22,101,809 (GRCm39) missense probably damaging 0.99
R0706:Reln UTSW 5 22,101,809 (GRCm39) missense probably damaging 0.99
R0959:Reln UTSW 5 22,432,626 (GRCm39) missense probably damaging 0.96
R1066:Reln UTSW 5 22,239,662 (GRCm39) missense probably damaging 1.00
R1110:Reln UTSW 5 22,239,773 (GRCm39) missense probably benign
R1163:Reln UTSW 5 22,104,027 (GRCm39) missense probably benign 0.03
R1222:Reln UTSW 5 22,191,953 (GRCm39) missense probably null 0.97
R1226:Reln UTSW 5 22,115,864 (GRCm39) missense probably damaging 1.00
R1440:Reln UTSW 5 22,333,600 (GRCm39) splice site probably benign
R1532:Reln UTSW 5 22,239,742 (GRCm39) missense probably damaging 0.99
R1552:Reln UTSW 5 22,165,376 (GRCm39) missense probably benign 0.01
R1565:Reln UTSW 5 22,130,211 (GRCm39) missense probably benign 0.05
R1618:Reln UTSW 5 22,265,366 (GRCm39) missense probably benign 0.01
R1636:Reln UTSW 5 22,203,681 (GRCm39) missense probably damaging 0.99
R1664:Reln UTSW 5 22,134,084 (GRCm39) missense probably damaging 1.00
R1716:Reln UTSW 5 22,160,093 (GRCm39) missense probably damaging 0.98
R1759:Reln UTSW 5 22,215,287 (GRCm39) missense probably damaging 0.99
R1835:Reln UTSW 5 22,184,000 (GRCm39) missense probably damaging 1.00
R1907:Reln UTSW 5 22,249,960 (GRCm39) critical splice donor site probably null
R1991:Reln UTSW 5 22,174,358 (GRCm39) missense possibly damaging 0.56
R2046:Reln UTSW 5 22,147,625 (GRCm39) missense probably benign 0.01
R2072:Reln UTSW 5 22,124,175 (GRCm39) missense probably damaging 1.00
R2103:Reln UTSW 5 22,174,358 (GRCm39) missense possibly damaging 0.56
R2119:Reln UTSW 5 22,223,998 (GRCm39) missense probably damaging 1.00
R2120:Reln UTSW 5 22,174,083 (GRCm39) missense probably damaging 1.00
R2216:Reln UTSW 5 22,253,003 (GRCm39) missense probably benign 0.30
R2219:Reln UTSW 5 22,177,045 (GRCm39) missense possibly damaging 0.88
R2228:Reln UTSW 5 22,192,076 (GRCm39) missense possibly damaging 0.69
R2306:Reln UTSW 5 22,101,784 (GRCm39) missense probably damaging 1.00
R2316:Reln UTSW 5 22,359,954 (GRCm39) missense probably benign 0.00
R2321:Reln UTSW 5 22,120,018 (GRCm39) missense probably damaging 0.99
R2512:Reln UTSW 5 22,184,688 (GRCm39) missense possibly damaging 0.89
R2519:Reln UTSW 5 22,549,367 (GRCm39) missense unknown
R2870:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2870:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2871:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R2872:Reln UTSW 5 22,254,789 (GRCm39) missense possibly damaging 0.95
R3195:Reln UTSW 5 22,245,418 (GRCm39) missense possibly damaging 0.72
R3545:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3546:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3547:Reln UTSW 5 22,432,598 (GRCm39) missense possibly damaging 0.64
R3706:Reln UTSW 5 22,200,587 (GRCm39) splice site probably benign
R3713:Reln UTSW 5 22,109,732 (GRCm39) missense probably damaging 0.99
R3770:Reln UTSW 5 22,153,564 (GRCm39) missense probably damaging 1.00
R3836:Reln UTSW 5 22,116,012 (GRCm39) missense probably damaging 1.00
R3887:Reln UTSW 5 22,115,847 (GRCm39) missense possibly damaging 0.92
R3972:Reln UTSW 5 22,183,999 (GRCm39) missense probably damaging 0.99
R3975:Reln UTSW 5 22,200,364 (GRCm39) missense possibly damaging 0.57
R4022:Reln UTSW 5 22,432,628 (GRCm39) missense probably benign 0.45
R4044:Reln UTSW 5 22,333,630 (GRCm39) missense possibly damaging 0.82
R4107:Reln UTSW 5 22,239,582 (GRCm39) missense probably damaging 1.00
R4297:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4298:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4299:Reln UTSW 5 22,125,485 (GRCm39) missense probably damaging 0.99
R4518:Reln UTSW 5 22,106,741 (GRCm39) missense probably benign 0.44
R4615:Reln UTSW 5 22,177,870 (GRCm39) missense possibly damaging 0.95
R4713:Reln UTSW 5 22,357,461 (GRCm39) missense probably benign 0.17
R4720:Reln UTSW 5 22,491,894 (GRCm39) missense possibly damaging 0.71
R4721:Reln UTSW 5 22,124,220 (GRCm39) missense probably damaging 0.99
R4771:Reln UTSW 5 22,254,698 (GRCm39) missense probably damaging 1.00
R4794:Reln UTSW 5 22,549,183 (GRCm39) missense probably damaging 0.98
R4840:Reln UTSW 5 22,223,844 (GRCm39) splice site probably null
R4860:Reln UTSW 5 22,106,749 (GRCm39) missense probably benign 0.06
R4860:Reln UTSW 5 22,106,749 (GRCm39) missense probably benign 0.06
R4896:Reln UTSW 5 22,160,236 (GRCm39) missense probably damaging 1.00
R4908:Reln UTSW 5 22,184,718 (GRCm39) missense probably benign 0.02
R4912:Reln UTSW 5 22,130,191 (GRCm39) missense probably benign 0.29
R4922:Reln UTSW 5 22,200,585 (GRCm39) critical splice acceptor site probably null
R4975:Reln UTSW 5 22,165,424 (GRCm39) missense probably damaging 1.00
R4976:Reln UTSW 5 22,176,868 (GRCm39) missense probably benign 0.05
R5020:Reln UTSW 5 22,239,636 (GRCm39) missense probably damaging 1.00
R5037:Reln UTSW 5 22,153,510 (GRCm39) missense probably damaging 1.00
R5082:Reln UTSW 5 22,101,075 (GRCm39) missense probably benign 0.00
R5119:Reln UTSW 5 22,176,868 (GRCm39) missense probably benign 0.05
R5125:Reln UTSW 5 22,118,239 (GRCm39) missense possibly damaging 0.78
R5137:Reln UTSW 5 22,160,179 (GRCm39) missense probably damaging 1.00
R5152:Reln UTSW 5 22,153,627 (GRCm39) missense probably damaging 1.00
R5154:Reln UTSW 5 22,193,763 (GRCm39) missense probably damaging 0.99
R5259:Reln UTSW 5 22,308,395 (GRCm39) missense possibly damaging 0.83
R5283:Reln UTSW 5 22,216,161 (GRCm39) missense probably damaging 1.00
R5386:Reln UTSW 5 22,244,527 (GRCm39) missense probably benign
R5400:Reln UTSW 5 22,184,712 (GRCm39) missense probably damaging 1.00
R5478:Reln UTSW 5 22,209,201 (GRCm39) missense probably benign 0.00
R5514:Reln UTSW 5 22,176,883 (GRCm39) missense possibly damaging 0.93
R5529:Reln UTSW 5 22,137,713 (GRCm39) missense possibly damaging 0.71
R5611:Reln UTSW 5 22,244,663 (GRCm39) nonsense probably null
R5648:Reln UTSW 5 22,203,570 (GRCm39) missense probably benign 0.04
R5744:Reln UTSW 5 22,311,081 (GRCm39) missense probably null 0.39
R5782:Reln UTSW 5 22,223,054 (GRCm39) missense probably benign 0.01
R5815:Reln UTSW 5 22,152,431 (GRCm39) missense probably damaging 0.99
R5838:Reln UTSW 5 22,104,111 (GRCm39) missense probably damaging 0.97
R6162:Reln UTSW 5 22,116,048 (GRCm39) missense probably damaging 1.00
R6219:Reln UTSW 5 22,153,594 (GRCm39) missense probably damaging 1.00
R6259:Reln UTSW 5 22,265,331 (GRCm39) missense probably damaging 0.99
R6279:Reln UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
R6299:Reln UTSW 5 22,491,942 (GRCm39) missense possibly damaging 0.71
R6300:Reln UTSW 5 22,101,839 (GRCm39) missense probably damaging 1.00
R6314:Reln UTSW 5 22,357,482 (GRCm39) nonsense probably null
R6351:Reln UTSW 5 22,106,661 (GRCm39) nonsense probably null
R6369:Reln UTSW 5 22,256,359 (GRCm39) missense probably benign 0.03
R6371:Reln UTSW 5 22,200,511 (GRCm39) missense probably benign
R6374:Reln UTSW 5 22,285,712 (GRCm39) missense probably benign 0.06
R6425:Reln UTSW 5 22,116,018 (GRCm39) nonsense probably null
R6442:Reln UTSW 5 22,137,774 (GRCm39) missense probably benign
R6445:Reln UTSW 5 22,124,212 (GRCm39) missense probably benign 0.05
R6554:Reln UTSW 5 22,101,838 (GRCm39) missense probably damaging 1.00
R6641:Reln UTSW 5 22,134,132 (GRCm39) missense probably damaging 1.00
R6768:Reln UTSW 5 22,183,905 (GRCm39) missense probably damaging 0.99
R6859:Reln UTSW 5 22,239,568 (GRCm39) missense probably damaging 1.00
R6896:Reln UTSW 5 22,104,177 (GRCm39) missense probably benign 0.18
R6932:Reln UTSW 5 22,190,855 (GRCm39) missense probably benign 0.00
R6948:Reln UTSW 5 22,177,033 (GRCm39) missense probably damaging 1.00
R6959:Reln UTSW 5 22,181,562 (GRCm39) missense probably damaging 1.00
R7085:Reln UTSW 5 22,120,085 (GRCm39) nonsense probably null
R7091:Reln UTSW 5 22,104,027 (GRCm39) missense probably null 0.08
R7135:Reln UTSW 5 22,181,594 (GRCm39) missense possibly damaging 0.95
R7146:Reln UTSW 5 22,311,095 (GRCm39) missense probably damaging 0.97
R7167:Reln UTSW 5 22,147,618 (GRCm39) missense probably damaging 1.00
R7190:Reln UTSW 5 22,252,945 (GRCm39) missense probably damaging 1.00
R7256:Reln UTSW 5 22,183,921 (GRCm39) missense probably benign 0.03
R7393:Reln UTSW 5 22,181,349 (GRCm39) missense probably damaging 0.99
R7399:Reln UTSW 5 22,256,365 (GRCm39) missense probably damaging 0.99
R7400:Reln UTSW 5 22,176,932 (GRCm39) missense probably damaging 0.99
R7426:Reln UTSW 5 22,176,951 (GRCm39) missense probably damaging 1.00
R7463:Reln UTSW 5 22,308,433 (GRCm39) missense probably damaging 0.98
R7470:Reln UTSW 5 22,147,739 (GRCm39) missense probably damaging 0.99
R7473:Reln UTSW 5 22,134,125 (GRCm39) missense probably benign 0.25
R7501:Reln UTSW 5 22,432,636 (GRCm39) missense possibly damaging 0.91
R7542:Reln UTSW 5 22,160,179 (GRCm39) missense probably damaging 1.00
R7544:Reln UTSW 5 22,181,276 (GRCm39) nonsense probably null
R7588:Reln UTSW 5 22,090,566 (GRCm39) missense probably benign 0.03
R7631:Reln UTSW 5 22,176,933 (GRCm39) missense probably damaging 0.97
R7644:Reln UTSW 5 22,183,929 (GRCm39) missense probably benign 0.39
R7834:Reln UTSW 5 22,244,633 (GRCm39) missense possibly damaging 0.94
R7923:Reln UTSW 5 22,339,690 (GRCm39) missense probably benign 0.00
R7938:Reln UTSW 5 22,155,870 (GRCm39) missense probably damaging 0.97
R8006:Reln UTSW 5 22,104,082 (GRCm39) nonsense probably null
R8062:Reln UTSW 5 22,176,990 (GRCm39) missense probably benign 0.00
R8222:Reln UTSW 5 22,136,475 (GRCm39) nonsense probably null
R8266:Reln UTSW 5 22,223,085 (GRCm39) missense possibly damaging 0.62
R8267:Reln UTSW 5 22,209,110 (GRCm39) missense probably damaging 1.00
R8487:Reln UTSW 5 22,104,027 (GRCm39) missense probably benign 0.03
R8523:Reln UTSW 5 22,209,229 (GRCm39) missense probably damaging 1.00
R8751:Reln UTSW 5 22,147,672 (GRCm39) missense probably benign 0.37
R8801:Reln UTSW 5 22,155,854 (GRCm39) missense possibly damaging 0.94
R8802:Reln UTSW 5 22,130,257 (GRCm39) missense probably damaging 0.98
R8978:Reln UTSW 5 22,090,512 (GRCm39) missense possibly damaging 0.85
R8988:Reln UTSW 5 22,104,155 (GRCm39) missense probably damaging 0.97
R8995:Reln UTSW 5 22,184,577 (GRCm39) missense probably benign 0.00
R9022:Reln UTSW 5 22,181,613 (GRCm39) missense possibly damaging 0.66
R9042:Reln UTSW 5 22,253,036 (GRCm39) missense probably damaging 1.00
R9069:Reln UTSW 5 22,216,059 (GRCm39) missense probably damaging 1.00
R9089:Reln UTSW 5 22,130,198 (GRCm39) missense probably benign 0.01
R9126:Reln UTSW 5 22,160,194 (GRCm39) missense probably damaging 1.00
R9172:Reln UTSW 5 22,155,815 (GRCm39) critical splice donor site probably null
R9182:Reln UTSW 5 22,106,617 (GRCm39) missense probably benign 0.44
R9196:Reln UTSW 5 22,357,471 (GRCm39) missense probably damaging 1.00
R9211:Reln UTSW 5 22,549,200 (GRCm39) nonsense probably null
R9241:Reln UTSW 5 22,174,067 (GRCm39) missense probably damaging 0.99
R9244:Reln UTSW 5 22,120,151 (GRCm39) missense probably damaging 0.99
R9281:Reln UTSW 5 22,153,545 (GRCm39) missense probably damaging 1.00
R9295:Reln UTSW 5 22,209,209 (GRCm39) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,193,705 (GRCm39) missense possibly damaging 0.95
R9303:Reln UTSW 5 22,285,689 (GRCm39) missense probably benign 0.01
R9309:Reln UTSW 5 22,176,866 (GRCm39) missense probably benign 0.37
R9338:Reln UTSW 5 22,202,937 (GRCm39) missense probably damaging 0.98
R9381:Reln UTSW 5 22,549,202 (GRCm39) missense possibly damaging 0.93
R9430:Reln UTSW 5 22,120,105 (GRCm39) missense probably damaging 1.00
R9509:Reln UTSW 5 22,549,198 (GRCm39) missense possibly damaging 0.93
R9515:Reln UTSW 5 22,125,508 (GRCm39) missense possibly damaging 0.46
R9717:Reln UTSW 5 22,136,427 (GRCm39) missense probably benign 0.26
R9745:Reln UTSW 5 22,152,525 (GRCm39) missense probably damaging 1.00
R9778:Reln UTSW 5 22,155,943 (GRCm39) missense probably damaging 1.00
Z1176:Reln UTSW 5 22,184,022 (GRCm39) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,209,080 (GRCm39) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,174,239 (GRCm39) missense probably damaging 0.96
Z1177:Reln UTSW 5 22,432,634 (GRCm39) missense probably damaging 1.00
Z1177:Reln UTSW 5 22,359,957 (GRCm39) missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AAGCCAGCGTTTTGTAGGC -3'
(R):5'- GAAAGCCTGTTAACTGTGTCTCC -3'

Sequencing Primer
(F):5'- GCTTTCAGTAATATAGCTCAAGGC -3'
(R):5'- CTTGGGTCTCTCAGTGCCAC -3'
Posted On 2016-11-08