Incidental Mutation 'R5545:Ifnar2'
ID 436202
Institutional Source Beutler Lab
Gene Symbol Ifnar2
Ensembl Gene ENSMUSG00000022971
Gene Name interferon (alpha and beta) receptor 2
Synonyms Ifnar-2
MMRRC Submission 043103-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.148) question?
Stock # R5545 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 91169671-91202477 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 91181913 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134796 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023693] [ENSMUST00000089042] [ENSMUST00000117836] [ENSMUST00000134491] [ENSMUST00000139503]
AlphaFold O35664
Predicted Effect probably null
Transcript: ENSMUST00000023693
SMART Domains Protein: ENSMUSP00000023693
Gene: ENSMUSG00000022971

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 8.9e-18 PFAM
Pfam:Interfer-bind 132 231 9.2e-19 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 361 389 N/A INTRINSIC
low complexity region 476 485 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000089042
SMART Domains Protein: ENSMUSP00000086443
Gene: ENSMUSG00000022971

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 2.9e-18 PFAM
Pfam:Interfer-bind 132 231 1.5e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117836
SMART Domains Protein: ENSMUSP00000113358
Gene: ENSMUSG00000022971

DomainStartEndE-ValueType
Pfam:Tissue_fac 9 118 2.9e-18 PFAM
Pfam:Interfer-bind 132 231 1.5e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000134491
SMART Domains Protein: ENSMUSP00000134796
Gene: ENSMUSG00000022971

DomainStartEndE-ValueType
Pfam:Interfer-bind 30 117 3.6e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139503
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a type I membrane protein that forms one of the two chains of a receptor for interferons alpha and beta. Binding and activation of the receptor stimulates Janus protein kinases, which in turn phosphorylate several proteins, including STAT1 and STAT2. Multiple transcript variants encoding at least two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice with mutations of this gene have defects in immune responses involving, variously, NK cells, CD4+ and CD8+ T cells and B cells in response to induced and transplanted tumors, viruses, and double stranded DNA. These defects include diminished secretion of type I and type II interferons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410004B18Rik T C 3: 145,644,853 (GRCm39) probably null Het
Acot5 G A 12: 84,116,380 (GRCm39) R47Q possibly damaging Het
Akr1c19 A T 13: 4,292,594 (GRCm39) Y205F probably benign Het
Cdh6 T C 15: 13,041,235 (GRCm39) Y564C probably damaging Het
Cngb1 A G 8: 95,978,801 (GRCm39) S551P Het
Cyp20a1 T C 1: 60,415,241 (GRCm39) I289T possibly damaging Het
Herc6 A T 6: 57,634,992 (GRCm39) probably null Het
Kcnd2 A G 6: 21,217,018 (GRCm39) T241A probably damaging Het
Nfatc2ip T A 7: 125,989,642 (GRCm39) E247D possibly damaging Het
Or2k2 T G 4: 58,785,585 (GRCm39) I46L probably benign Het
Or2o1 G A 11: 49,051,453 (GRCm39) C204Y probably damaging Het
Pate10 A G 9: 35,652,940 (GRCm39) I61V probably benign Het
Plekhg2 T C 7: 28,061,886 (GRCm39) E638G probably damaging Het
Plin1 T C 7: 79,376,257 (GRCm39) T160A probably benign Het
Prox1 T A 1: 189,879,339 (GRCm39) N613I probably damaging Het
Ptpn13 A G 5: 103,709,830 (GRCm39) S1498G probably damaging Het
Ralbp1 C T 17: 66,157,099 (GRCm39) R598Q possibly damaging Het
Robo2 A C 16: 73,758,635 (GRCm39) V712G probably damaging Het
Rsl1d1 A G 16: 11,017,514 (GRCm39) F151L probably damaging Het
Scrn3 T A 2: 73,166,125 (GRCm39) I386N possibly damaging Het
Sorl1 T A 9: 41,902,921 (GRCm39) Y1591F probably benign Het
Tbr1 T G 2: 61,637,720 (GRCm39) V93G possibly damaging Het
Tmem229b A G 12: 79,011,583 (GRCm39) I116T probably damaging Het
Ttn T C 2: 76,594,720 (GRCm39) Q12115R possibly damaging Het
Ube3a C T 7: 58,921,772 (GRCm39) T48M probably damaging Het
Vnn3 A G 10: 23,742,992 (GRCm39) I401V probably benign Het
Wdr90 C T 17: 26,064,830 (GRCm39) R1744H probably damaging Het
Zc3h7a T C 16: 10,966,315 (GRCm39) D604G possibly damaging Het
Other mutations in Ifnar2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Ifnar2 APN 16 91,188,599 (GRCm39) unclassified probably benign
IGL02817:Ifnar2 APN 16 91,184,880 (GRCm39) missense probably benign 0.01
macro-2 UTSW 16 91,180,787 (GRCm39) start codon destroyed probably null
R0701:Ifnar2 UTSW 16 91,201,117 (GRCm39) missense possibly damaging 0.53
R1342:Ifnar2 UTSW 16 91,200,809 (GRCm39) missense possibly damaging 0.85
R1542:Ifnar2 UTSW 16 91,196,153 (GRCm39) missense possibly damaging 0.95
R1631:Ifnar2 UTSW 16 91,188,755 (GRCm39) missense probably benign 0.00
R1913:Ifnar2 UTSW 16 91,201,058 (GRCm39) missense probably benign 0.33
R3078:Ifnar2 UTSW 16 91,182,889 (GRCm39) missense possibly damaging 0.86
R4193:Ifnar2 UTSW 16 91,201,232 (GRCm39) missense probably damaging 0.98
R4592:Ifnar2 UTSW 16 91,188,684 (GRCm39) missense probably benign
R5385:Ifnar2 UTSW 16 91,201,086 (GRCm39) missense possibly damaging 0.70
R5645:Ifnar2 UTSW 16 91,201,115 (GRCm39) missense possibly damaging 0.85
R6223:Ifnar2 UTSW 16 91,184,876 (GRCm39) missense probably damaging 0.98
R6371:Ifnar2 UTSW 16 91,184,986 (GRCm39) missense possibly damaging 0.95
R6710:Ifnar2 UTSW 16 91,190,771 (GRCm39) missense probably damaging 0.98
R6929:Ifnar2 UTSW 16 91,190,766 (GRCm39) nonsense probably null
R7530:Ifnar2 UTSW 16 91,201,201 (GRCm39) missense probably benign 0.18
R7763:Ifnar2 UTSW 16 91,196,181 (GRCm39) missense probably benign 0.02
R8444:Ifnar2 UTSW 16 91,200,857 (GRCm39) missense possibly damaging 0.93
R8529:Ifnar2 UTSW 16 91,188,684 (GRCm39) missense possibly damaging 0.77
R8969:Ifnar2 UTSW 16 91,201,060 (GRCm39) missense probably benign 0.18
R9016:Ifnar2 UTSW 16 91,201,073 (GRCm39) missense possibly damaging 0.96
R9667:Ifnar2 UTSW 16 91,184,984 (GRCm39) missense probably benign 0.01
R9765:Ifnar2 UTSW 16 91,184,975 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GAGCATCCATACTCTCCACAGG -3'
(R):5'- TTCAGTGTGCCTTTAAGAGGGC -3'

Sequencing Primer
(F):5'- CTCCACAGGATTTTTGTTAGCACAAG -3'
(R):5'- AGCATATCTGGGGTCAGA -3'
Posted On 2016-10-24