Incidental Mutation 'R5483:Ipo5'
ID 434442
Institutional Source Beutler Lab
Gene Symbol Ipo5
Ensembl Gene ENSMUSG00000030662
Gene Name importin 5
Synonyms 1110011C18Rik, RanBP5, Kpnb3, importin beta 3, IMB3, 5730478E03Rik
MMRRC Submission 043044-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.928) question?
Stock # R5483 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 121148636-121185411 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121157450 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 96 (I96N)
Ref Sequence ENSEMBL: ENSMUSP00000032898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032898]
AlphaFold Q8BKC5
Predicted Effect probably benign
Transcript: ENSMUST00000032898
AA Change: I96N

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000032898
Gene: ENSMUSG00000030662
AA Change: I96N

DomainStartEndE-ValueType
low complexity region 65 72 N/A INTRINSIC
Pfam:HEAT_2 359 467 3.3e-13 PFAM
Pfam:HEAT_EZ 372 426 3.7e-10 PFAM
Pfam:Vac14_Fab1_bd 373 430 3.8e-9 PFAM
Pfam:HEAT 400 430 4.2e-7 PFAM
Pfam:HEAT 906 936 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228277
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 97.5%
  • 10x: 94.8%
  • 20x: 89.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(33) : Targeted, other(2) Gene trapped(31)

Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cfap206 G T 4: 34,711,404 (GRCm39) Q498K probably benign Het
Dnmt3a A G 12: 3,949,615 (GRCm39) Y524C probably damaging Het
Dnttip2 A T 3: 122,070,446 (GRCm39) T554S probably damaging Het
Emc1 A G 4: 139,102,687 (GRCm39) T949A probably damaging Het
Enkur A T 2: 21,199,109 (GRCm39) F142I probably benign Het
Fbxo24 C T 5: 137,617,002 (GRCm39) A362T probably damaging Het
Heatr1 A G 13: 12,413,795 (GRCm39) H124R probably damaging Het
Hira T A 16: 18,788,290 (GRCm39) I1011N possibly damaging Het
Kctd16 A G 18: 40,663,929 (GRCm39) I353V probably benign Het
Klf11 T A 12: 24,705,410 (GRCm39) L288* probably null Het
Kmt2a A T 9: 44,735,921 (GRCm39) probably benign Het
Lmbrd1 T C 1: 24,783,989 (GRCm39) Y373H probably damaging Het
Mlh1 G A 9: 111,060,126 (GRCm39) A584V possibly damaging Het
Ociad1 T C 5: 73,452,314 (GRCm39) F35S probably damaging Het
Or11l3 T A 11: 58,516,783 (GRCm39) I30F possibly damaging Het
Or6c208 T C 10: 129,223,526 (GRCm39) I8T probably benign Het
Or8u3-ps C T 2: 85,952,962 (GRCm39) Q232* probably null Het
Pkd1l1 C T 11: 8,851,141 (GRCm39) probably null Het
Pole T A 5: 110,442,434 (GRCm39) D287E probably damaging Het
Polh G T 17: 46,483,671 (GRCm39) S531R probably benign Het
Prss29 A G 17: 25,541,177 (GRCm39) K207R probably benign Het
Rasgrp3 T G 17: 75,832,013 (GRCm39) S611R probably damaging Het
Rffl G T 11: 82,703,549 (GRCm39) probably null Het
Scrib A G 15: 75,939,508 (GRCm39) probably null Het
Serpinb3a T A 1: 106,974,899 (GRCm39) K211N probably benign Het
Slc22a3 C T 17: 12,683,354 (GRCm39) A170T probably damaging Het
Socs5 T G 17: 87,442,402 (GRCm39) F447L probably damaging Het
Srrm2 T A 17: 24,040,246 (GRCm39) S2393T probably damaging Het
Usp7 T A 16: 8,516,404 (GRCm39) Y585F probably benign Het
Vps39 A T 2: 120,153,564 (GRCm39) I670N probably benign Het
Other mutations in Ipo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Ipo5 APN 14 121,165,945 (GRCm39) missense probably damaging 0.98
IGL01614:Ipo5 APN 14 121,172,507 (GRCm39) missense probably benign 0.01
IGL01835:Ipo5 APN 14 121,163,650 (GRCm39) missense probably benign 0.24
IGL02010:Ipo5 APN 14 121,170,789 (GRCm39) missense probably benign 0.20
IGL02303:Ipo5 APN 14 121,154,795 (GRCm39) missense probably benign
IGL02344:Ipo5 APN 14 121,180,191 (GRCm39) splice site probably benign
IGL02657:Ipo5 APN 14 121,181,212 (GRCm39) missense possibly damaging 0.47
IGL03094:Ipo5 APN 14 121,181,089 (GRCm39) splice site probably benign
IGL03158:Ipo5 APN 14 121,179,303 (GRCm39) splice site probably benign
IGL03309:Ipo5 APN 14 121,157,416 (GRCm39) missense probably benign
IGL03392:Ipo5 APN 14 121,180,099 (GRCm39) missense probably damaging 0.99
3-1:Ipo5 UTSW 14 121,170,348 (GRCm39) missense probably benign 0.41
PIT4544001:Ipo5 UTSW 14 121,165,949 (GRCm39) missense probably damaging 0.99
R0326:Ipo5 UTSW 14 121,159,635 (GRCm39) missense probably benign 0.19
R0505:Ipo5 UTSW 14 121,180,145 (GRCm39) missense possibly damaging 0.74
R0559:Ipo5 UTSW 14 121,176,053 (GRCm39) missense probably damaging 1.00
R0590:Ipo5 UTSW 14 121,181,769 (GRCm39) missense possibly damaging 0.76
R0969:Ipo5 UTSW 14 121,181,937 (GRCm39) missense possibly damaging 0.64
R1450:Ipo5 UTSW 14 121,181,805 (GRCm39) missense probably benign 0.04
R1672:Ipo5 UTSW 14 121,170,714 (GRCm39) missense probably damaging 1.00
R2471:Ipo5 UTSW 14 121,159,574 (GRCm39) missense probably benign 0.12
R3508:Ipo5 UTSW 14 121,176,956 (GRCm39) missense probably damaging 1.00
R3696:Ipo5 UTSW 14 121,159,574 (GRCm39) missense probably benign 0.12
R4118:Ipo5 UTSW 14 121,176,073 (GRCm39) missense probably benign 0.04
R4418:Ipo5 UTSW 14 121,181,305 (GRCm39) missense possibly damaging 0.81
R4760:Ipo5 UTSW 14 121,179,054 (GRCm39) missense probably benign 0.02
R4839:Ipo5 UTSW 14 121,157,450 (GRCm39) missense probably benign 0.00
R4913:Ipo5 UTSW 14 121,172,498 (GRCm39) missense probably damaging 1.00
R5326:Ipo5 UTSW 14 121,163,683 (GRCm39) missense probably benign
R5339:Ipo5 UTSW 14 121,181,122 (GRCm39) missense probably damaging 1.00
R5542:Ipo5 UTSW 14 121,163,683 (GRCm39) missense probably benign
R5579:Ipo5 UTSW 14 121,176,025 (GRCm39) missense probably benign 0.26
R5954:Ipo5 UTSW 14 121,157,396 (GRCm39) missense probably damaging 1.00
R6948:Ipo5 UTSW 14 121,160,527 (GRCm39) missense probably benign 0.00
R7365:Ipo5 UTSW 14 121,157,497 (GRCm39) missense probably benign
R7563:Ipo5 UTSW 14 121,183,567 (GRCm39) missense probably benign 0.00
R7782:Ipo5 UTSW 14 121,170,537 (GRCm39) missense possibly damaging 0.95
R7911:Ipo5 UTSW 14 121,167,051 (GRCm39) splice site probably null
R8222:Ipo5 UTSW 14 121,157,414 (GRCm39) missense probably benign 0.00
R8238:Ipo5 UTSW 14 121,172,652 (GRCm39) missense probably damaging 1.00
R8483:Ipo5 UTSW 14 121,183,560 (GRCm39) missense probably benign
R8826:Ipo5 UTSW 14 121,157,366 (GRCm39) missense probably damaging 1.00
R9042:Ipo5 UTSW 14 121,160,547 (GRCm39) missense probably benign 0.01
W0251:Ipo5 UTSW 14 121,176,197 (GRCm39) missense probably benign 0.17
X0062:Ipo5 UTSW 14 121,179,083 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GTGAAACCCATCAATGGCAC -3'
(R):5'- TAGTACAGACTTGAAACCACGGC -3'

Sequencing Primer
(F):5'- CACAGGGTTGGAAATCTTTTCTC -3'
(R):5'- GACAGAACATGCATGTGCC -3'
Posted On 2016-10-06