Mutagenetix > Incidental Mutation

Incidental Mutation 'R0478:4930432E11Rik'

43200

Institutional Source

Beutler Lab

Gene Symbol

4930432E11Rik

Ensembl Gene

ENSMUSG00000046958

Gene Name

RIKEN cDNA 4930432E11 gene

Synonyms

MMRRC Submission

038678-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.082) question?

Stock #

R0478 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

29255998-29276204 bp(+) (GRCm39)

Type of Mutation

exon

DNA Base Change (assembly)

A to T at 29262014 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Gene Model

predicted gene model for transcript(s):

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000053635

SMART Domains

Protein: ENSMUSP00000049518
Gene: ENSMUSG00000046958

Domain	Start	End	E-Value	Type
Blast:WD40	43	79	3e-11	BLAST
WD40	131	172	1.97e2	SMART
WD40	175	214	2.24e-2	SMART
Blast:WD40	257	296	4e-15	BLAST
WD40	393	437	1.32e2	SMART
WD40	494	533	2.15e-4	SMART
low complexity region	598	617	N/A	INTRINSIC
low complexity region	1082	1094	N/A	INTRINSIC
low complexity region	1107	1148	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000063585

SMART Domains

Protein: ENSMUSP00000063695
Gene: ENSMUSG00000051976

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
internal_repeat_1	35	67	3.29e-5	PROSPERO
internal_repeat_1	73	102	3.29e-5	PROSPERO
low complexity region	122	135	N/A	INTRINSIC
coiled coil region	161	182	N/A	INTRINSIC
low complexity region	216	233	N/A	INTRINSIC
low complexity region	239	249	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000185541

Coding Region Coverage

1x: 99.7%
3x: 99.0%
10x: 97.2%
20x: 94.9%

Validation Efficiency

100% (49/49)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930556J24Rik	T	G	11: 3,926,259 (GRCm39)		probably benign	Het
Acnat1	T	G	4: 49,450,901 (GRCm39)	D70A	probably damaging	Het
Adnp2	A	G	18: 80,172,549 (GRCm39)	V620A	probably benign	Het
Aldoart1	T	A	4: 72,770,580 (GRCm39)	H21L	probably benign	Het
Birc2	A	G	9: 7,860,348 (GRCm39)	V290A	probably damaging	Het
Bpifb3	C	T	2: 153,773,400 (GRCm39)		probably benign	Het
Camta1	C	A	4: 151,159,597 (GRCm39)	R1614L	probably damaging	Het
Clmn	A	G	12: 104,751,750 (GRCm39)	M235T	probably damaging	Het
Dmbt1	A	G	7: 130,642,917 (GRCm39)	E245G	possibly damaging	Het
Epgn	G	T	5: 91,178,987 (GRCm39)	V36L	probably benign	Het
Ets2	C	A	16: 95,517,306 (GRCm39)	P346Q	probably damaging	Het
Fam222b	T	C	11: 78,044,682 (GRCm39)	L81P	probably damaging	Het
Fancf	A	C	7: 51,511,440 (GRCm39)	L188R	probably damaging	Het
Fibin	T	C	2: 110,193,079 (GRCm39)	D21G	possibly damaging	Het
Fzd6	A	G	15: 38,897,429 (GRCm39)		probably null	Het
Gbp4	T	A	5: 105,267,299 (GRCm39)	Q540L	probably benign	Het
Greb1l	T	A	18: 10,509,281 (GRCm39)	L531Q	probably damaging	Het
Il5ra	A	G	6: 106,715,423 (GRCm39)	V137A	probably benign	Het
Kif26a	G	A	12: 112,142,223 (GRCm39)	A826T	probably damaging	Het
Kiz	T	C	2: 146,784,078 (GRCm39)	V537A	possibly damaging	Het
Klhl32	C	T	4: 24,792,777 (GRCm39)	G15D	probably damaging	Het
Kmt2d	G	A	15: 98,751,462 (GRCm39)		probably benign	Het
Lbp	T	C	2: 158,159,448 (GRCm39)		probably benign	Het
Mmp25	T	C	17: 23,851,756 (GRCm39)	T318A	probably benign	Het
Mrpl50	A	G	4: 49,514,513 (GRCm39)	C53R	probably damaging	Het
Msl3l2	G	C	10: 55,991,411 (GRCm39)	E45D	probably damaging	Het
Nfxl1	A	G	5: 72,681,988 (GRCm39)		probably null	Het
Noc3l	A	G	19: 38,798,450 (GRCm39)		probably null	Het
Or12e7	T	A	2: 87,288,370 (GRCm39)	V287E	probably damaging	Het
Or1x6	T	C	11: 50,939,539 (GRCm39)	S202P	probably benign	Het
Pgm5	A	T	19: 24,812,233 (GRCm39)	S100T	possibly damaging	Het
Pi4ka	C	T	16: 17,127,175 (GRCm39)	G1093S	possibly damaging	Het
Pitrm1	T	A	13: 6,609,431 (GRCm39)	S350T	probably damaging	Het
Ptk2b	G	T	14: 66,450,821 (GRCm39)	N48K	probably damaging	Het
Septin3	T	C	15: 82,175,007 (GRCm39)	L172P	probably damaging	Het
Sirt3	A	T	7: 140,458,027 (GRCm39)	C41S		Het
Sphkap	C	T	1: 83,256,432 (GRCm39)	R152H	probably damaging	Het
St3gal1	T	C	15: 66,985,579 (GRCm39)	Y25C	probably damaging	Het
Tbc1d31	T	C	15: 57,795,932 (GRCm39)	F175S	probably damaging	Het
Tfdp2	T	A	9: 96,172,636 (GRCm39)	D43E	probably benign	Het
Tgm1	G	A	14: 55,937,791 (GRCm39)	Q773*	probably null	Het
Tmc3	A	T	7: 83,271,360 (GRCm39)	R837S	possibly damaging	Het
Unc13a	A	G	8: 72,103,792 (GRCm39)	V880A	possibly damaging	Het
Vmn1r237	T	A	17: 21,535,081 (GRCm39)	V268E	probably damaging	Het
Zan	C	T	5: 137,398,788 (GRCm39)		probably benign	Het
Zfp760	G	T	17: 21,940,995 (GRCm39)	E57*	probably null	Het

Other mutations in 4930432E11Rik

Allele	Source	Chr	Coord	Type	Predicted Effect
IGL01121:4930432E11Rik	APN	7	29,273,426 (GRCm39)	unclassified	noncoding transcript
IGL01955:4930432E11Rik	APN	7	29,273,420 (GRCm39)	unclassified	noncoding transcript
IGL01971:4930432E11Rik	APN	7	29,273,987 (GRCm39)	unclassified	noncoding transcript
IGL02132:4930432E11Rik	APN	7	29,262,704 (GRCm39)	unclassified	noncoding transcript
IGL02484:4930432E11Rik	APN	7	29,262,777 (GRCm39)	unclassified	noncoding transcript
P0016:4930432E11Rik	UTSW	7	29,262,537 (GRCm39)	unclassified	noncoding transcript
R0051:4930432E11Rik	UTSW	7	29,278,526 (GRCm39)	exon	noncoding transcript
R0060:4930432E11Rik	UTSW	7	29,273,595 (GRCm39)	unclassified	noncoding transcript
R0094:4930432E11Rik	UTSW	7	29,260,236 (GRCm39)	exon	noncoding transcript
R0268:4930432E11Rik	UTSW	7	29,274,027 (GRCm39)	unclassified	noncoding transcript
R0423:4930432E11Rik	UTSW	7	29,261,825 (GRCm39)	exon	noncoding transcript
R0646:4930432E11Rik	UTSW	7	29,260,710 (GRCm39)	exon	noncoding transcript
R1208:4930432E11Rik	UTSW	7	29,260,708 (GRCm39)	exon	noncoding transcript
R1778:4930432E11Rik	UTSW	7	29,260,131 (GRCm39)	exon	noncoding transcript
R1779:4930432E11Rik	UTSW	7	29,278,591 (GRCm39)	exon	noncoding transcript
R1918:4930432E11Rik	UTSW	7	29,273,514 (GRCm39)	unclassified	noncoding transcript
R2360:4930432E11Rik	UTSW	7	29,274,214 (GRCm39)	unclassified	noncoding transcript
R3736:4930432E11Rik	UTSW	7	29,273,996 (GRCm39)	unclassified	noncoding transcript
R3780:4930432E11Rik	UTSW	7	29,260,263 (GRCm39)	exon	noncoding transcript
R4427:4930432E11Rik	UTSW	7	29,278,678 (GRCm39)	exon	noncoding transcript
R4835:4930432E11Rik	UTSW	7	29,274,326 (GRCm39)	unclassified	noncoding transcript
R4929:4930432E11Rik	UTSW	7	29,273,467 (GRCm39)	unclassified	noncoding transcript
R5042:4930432E11Rik	UTSW	7	29,273,927 (GRCm39)	unclassified	noncoding transcript
R5129:4930432E11Rik	UTSW	7	29,260,786 (GRCm39)	exon	noncoding transcript
R5371:4930432E11Rik	UTSW	7	29,261,918 (GRCm39)	exon	noncoding transcript
R5381:4930432E11Rik	UTSW	7	29,262,393 (GRCm39)	unclassified	noncoding transcript
R5586:4930432E11Rik	UTSW	7	29,277,153 (GRCm39)	unclassified	noncoding transcript
R5874:4930432E11Rik	UTSW	7	29,280,610 (GRCm39)	exon	noncoding transcript

Predicted Primers

PCR Primer
(F):5'- CATAGTGTCCTGCCTAAACCTGCTC -3'
(R):5'- CAATGGTTCAGGAACCTCCTCAGC -3'

Sequencing Primer
(F):5'- GATAAACCTAAACACTTTGACCTTCG -3'
(R):5'- TCAGCCATCTCTTCATAGGATAAAC -3'

Posted On

2013-05-23