Incidental Mutation 'R5442:Inpp5d'
ID 427208
Institutional Source Beutler Lab
Gene Symbol Inpp5d
Ensembl Gene ENSMUSG00000026288
Gene Name inositol polyphosphate-5-phosphatase D
Synonyms SHIP1, Src homology 2 domain-containing inositol-5-phosphatase, s-SHIP, SHIP, SHIP-1
MMRRC Submission 043007-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.914) question?
Stock # R5442 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 87548034-87648229 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 87645788 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Threonine at position 1058 (A1058T)
Ref Sequence ENSEMBL: ENSMUSP00000131244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042275] [ENSMUST00000072999] [ENSMUST00000167032] [ENSMUST00000168783] [ENSMUST00000169754] [ENSMUST00000170300]
AlphaFold Q9ES52
Predicted Effect probably benign
Transcript: ENSMUST00000042275
AA Change: A1118T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000044647
Gene: ENSMUSG00000026288
AA Change: A1118T

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 954 979 N/A INTRINSIC
low complexity region 1045 1057 N/A INTRINSIC
low complexity region 1119 1131 N/A INTRINSIC
low complexity region 1139 1148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072999
SMART Domains Protein: ENSMUSP00000072763
Gene: ENSMUSG00000026288

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 120 N/A INTRINSIC
IPPc 404 720 4.5e-104 SMART
low complexity region 767 777 N/A INTRINSIC
low complexity region 932 953 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167032
AA Change: A856T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000126569
Gene: ENSMUSG00000026288
AA Change: A856T

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 692 717 N/A INTRINSIC
low complexity region 783 795 N/A INTRINSIC
low complexity region 857 869 N/A INTRINSIC
low complexity region 877 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168783
AA Change: A1058T

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131244
Gene: ENSMUSG00000026288
AA Change: A1058T

DomainStartEndE-ValueType
SH2 6 95 7.15e-29 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 4.5e-104 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 985 997 N/A INTRINSIC
low complexity region 1059 1071 N/A INTRINSIC
low complexity region 1079 1088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169754
AA Change: A1119T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000127941
Gene: ENSMUSG00000026288
AA Change: A1119T

DomainStartEndE-ValueType
SH2 6 95 4.6e-31 SMART
low complexity region 107 118 N/A INTRINSIC
IPPc 405 721 2.2e-106 SMART
low complexity region 768 778 N/A INTRINSIC
low complexity region 955 980 N/A INTRINSIC
low complexity region 1046 1058 N/A INTRINSIC
low complexity region 1120 1132 N/A INTRINSIC
low complexity region 1140 1149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170300
AA Change: A795T

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000132384
Gene: ENSMUSG00000026288
AA Change: A795T

DomainStartEndE-ValueType
IPPc 142 458 4.5e-104 SMART
low complexity region 505 515 N/A INTRINSIC
low complexity region 722 734 N/A INTRINSIC
low complexity region 796 808 N/A INTRINSIC
low complexity region 816 825 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the inositol polyphosphate-5-phosphatase (INPP5) family and encodes a protein with an N-terminal SH2 domain, an inositol phosphatase domain, and two C-terminal protein interaction domains. Expression of this protein is restricted to hematopoietic cells where its movement from the cytosol to the plasma membrane is mediated by tyrosine phosphorylation. At the plasma membrane, the protein hydrolyzes the 5' phosphate from phosphatidylinositol (3,4,5)-trisphosphate and inositol-1,3,4,5-tetrakisphosphate, thereby affecting multiple signaling pathways. The protein is also partly localized to the nucleus, where it may be involved in nuclear inositol phosphate signaling processes. Overall, the protein functions as a negative regulator of myeloid cell proliferation and survival. Mutations in this gene are associated with defects and cancers of the immune system. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice fail to reject fully mismatched allogeneic marrow grafts, do not develop graft versus host disease, and show enhanced survival after such transplants. Homozygous splice site mutants exhibit wasting, granulocytic lung infiltration anddefective cytolysis by NK cells and CTLs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 119,909,594 (GRCm39) M114T probably benign Het
Ablim3 A T 18: 61,990,296 (GRCm39) probably null Het
Adcy10 A G 1: 165,340,709 (GRCm39) D238G probably benign Het
Astn2 G T 4: 65,500,023 (GRCm39) S955R possibly damaging Het
Casc3 A G 11: 98,712,297 (GRCm39) E112G probably damaging Het
Cetn4 C T 3: 37,364,094 (GRCm39) V39I probably benign Het
Commd4 A G 9: 57,064,090 (GRCm39) V37A possibly damaging Het
Dyrk2 T C 10: 118,696,643 (GRCm39) Q205R possibly damaging Het
Gal3st4 A G 5: 138,264,042 (GRCm39) V319A possibly damaging Het
Lpin3 A G 2: 160,746,936 (GRCm39) Y781C probably damaging Het
Lrat C T 3: 82,810,527 (GRCm39) V165M probably damaging Het
Ltbr G A 6: 125,289,757 (GRCm39) R146W probably damaging Het
Nlrp6 T C 7: 140,502,103 (GRCm39) S142P probably benign Het
Oas1a T C 5: 121,035,269 (GRCm39) T349A probably benign Het
Or52e8 A T 7: 104,624,435 (GRCm39) F252L possibly damaging Het
Or5m3b T C 2: 85,872,295 (GRCm39) V212A probably benign Het
Or5v1 A T 17: 37,810,330 (GRCm39) I263F probably damaging Het
Or8c20 T A 9: 38,261,158 (GRCm39) S260T probably benign Het
Pakap C A 4: 57,637,876 (GRCm39) P18Q probably null Het
Pcdha2 T C 18: 37,072,915 (GRCm39) V182A probably benign Het
Phactr3 A G 2: 177,784,254 (GRCm39) D26G probably benign Het
Phrf1 G A 7: 140,820,850 (GRCm39) R159H probably damaging Het
R3hdm4 C T 10: 79,748,292 (GRCm39) E162K possibly damaging Het
Rab3ip T C 10: 116,754,753 (GRCm39) T268A probably benign Het
Rapgef3 T C 15: 97,656,742 (GRCm39) D299G probably damaging Het
Rem1 A G 2: 152,469,977 (GRCm39) probably null Het
Slc28a2b A G 2: 122,317,350 (GRCm39) N36S probably benign Het
Syne1 A G 10: 5,293,473 (GRCm39) M1286T probably benign Het
Thsd7a T C 6: 12,748,799 (GRCm39) T52A probably benign Het
Tmem135 A T 7: 88,793,872 (GRCm39) F390Y probably damaging Het
Trio T C 15: 27,856,280 (GRCm39) D696G probably benign Het
Ttll11 T C 2: 35,793,135 (GRCm39) *191W probably null Het
Ubr4 A G 4: 139,135,083 (GRCm39) D805G probably damaging Het
Usp9y A G Y: 1,336,467 (GRCm39) I1469T possibly damaging Het
Vmn1r70 G T 7: 10,367,877 (GRCm39) A122S possibly damaging Het
Vmn2r78 G T 7: 86,569,330 (GRCm39) L74F possibly damaging Het
Wdfy3 T C 5: 102,044,425 (GRCm39) E1860G probably benign Het
Other mutations in Inpp5d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Inpp5d APN 1 87,611,537 (GRCm39) missense probably benign 0.00
IGL00329:Inpp5d APN 1 87,595,725 (GRCm39) missense probably benign 0.00
IGL00897:Inpp5d APN 1 87,639,836 (GRCm39) missense probably benign 0.14
IGL01314:Inpp5d APN 1 87,611,472 (GRCm39) nonsense probably null
IGL02145:Inpp5d APN 1 87,642,777 (GRCm39) missense probably damaging 1.00
IGL02422:Inpp5d APN 1 87,635,854 (GRCm39) missense probably damaging 1.00
IGL02538:Inpp5d APN 1 87,623,088 (GRCm39) missense probably null 0.92
IGL02680:Inpp5d APN 1 87,629,205 (GRCm39) missense possibly damaging 0.87
IGL03083:Inpp5d APN 1 87,638,863 (GRCm39) missense probably damaging 1.00
IGL03308:Inpp5d APN 1 87,630,919 (GRCm39) missense probably damaging 1.00
americas UTSW 1 87,642,864 (GRCm39) missense probably damaging 1.00
Apfelsine UTSW 1 87,611,567 (GRCm39) nonsense probably null
Auburn UTSW 1 87,609,402 (GRCm39) splice site probably null
Autumnal UTSW 1 87,619,433 (GRCm39) missense probably damaging 0.97
Gourd UTSW 1 87,625,337 (GRCm39) intron probably benign
lyda UTSW 1 87,611,484 (GRCm39) missense probably damaging 1.00
Mandarin UTSW 1 87,637,348 (GRCm39) missense probably damaging 0.99
naranjo UTSW 1 87,635,933 (GRCm39) critical splice donor site probably null
New_black UTSW 1 87,637,397 (GRCm39) missense probably damaging 1.00
Orange UTSW 1 87,625,268 (GRCm39) critical splice donor site probably null
pantone UTSW 1 87,627,397 (GRCm39) missense probably damaging 1.00
sailing UTSW 1 87,633,686 (GRCm39) missense probably damaging 1.00
Salamander UTSW 1 87,623,102 (GRCm39) missense probably damaging 0.99
Sandstone UTSW 1 87,623,122 (GRCm39) missense probably damaging 1.00
styx UTSW 1 87,597,506 (GRCm39) critical splice donor site probably benign
tangerine UTSW 1 87,633,671 (GRCm39) missense probably damaging 1.00
ulster UTSW 1 87,629,198 (GRCm39) nonsense probably null
R0010:Inpp5d UTSW 1 87,625,268 (GRCm39) critical splice donor site probably null
R0037:Inpp5d UTSW 1 87,635,851 (GRCm39) missense probably damaging 0.99
R0087:Inpp5d UTSW 1 87,642,860 (GRCm39) missense probably damaging 1.00
R0492:Inpp5d UTSW 1 87,625,872 (GRCm39) missense possibly damaging 0.94
R0520:Inpp5d UTSW 1 87,633,642 (GRCm39) splice site probably benign
R0733:Inpp5d UTSW 1 87,595,799 (GRCm39) splice site probably benign
R1464:Inpp5d UTSW 1 87,625,827 (GRCm39) splice site probably benign
R1576:Inpp5d UTSW 1 87,609,280 (GRCm39) missense probably damaging 0.96
R1576:Inpp5d UTSW 1 87,597,407 (GRCm39) missense probably benign 0.16
R1592:Inpp5d UTSW 1 87,593,254 (GRCm39) missense possibly damaging 0.90
R1750:Inpp5d UTSW 1 87,626,803 (GRCm39) missense probably damaging 1.00
R1774:Inpp5d UTSW 1 87,595,611 (GRCm39) missense probably benign 0.30
R1972:Inpp5d UTSW 1 87,604,036 (GRCm39) missense probably benign 0.00
R2024:Inpp5d UTSW 1 87,623,072 (GRCm39) nonsense probably null
R2405:Inpp5d UTSW 1 87,627,451 (GRCm39) missense possibly damaging 0.94
R3412:Inpp5d UTSW 1 87,595,779 (GRCm39) missense possibly damaging 0.93
R3414:Inpp5d UTSW 1 87,595,779 (GRCm39) missense possibly damaging 0.93
R3756:Inpp5d UTSW 1 87,629,130 (GRCm39) splice site probably benign
R4652:Inpp5d UTSW 1 87,593,173 (GRCm39) missense probably benign 0.03
R4676:Inpp5d UTSW 1 87,642,864 (GRCm39) missense probably damaging 1.00
R4834:Inpp5d UTSW 1 87,625,245 (GRCm39) missense possibly damaging 0.52
R5086:Inpp5d UTSW 1 87,633,686 (GRCm39) missense probably damaging 1.00
R5159:Inpp5d UTSW 1 87,604,064 (GRCm39) missense probably damaging 1.00
R5250:Inpp5d UTSW 1 87,637,397 (GRCm39) missense probably damaging 1.00
R5875:Inpp5d UTSW 1 87,645,696 (GRCm39) missense possibly damaging 0.47
R6135:Inpp5d UTSW 1 87,548,119 (GRCm39) splice site probably null
R6371:Inpp5d UTSW 1 87,627,397 (GRCm39) missense probably damaging 1.00
R6385:Inpp5d UTSW 1 87,627,397 (GRCm39) missense probably damaging 1.00
R6386:Inpp5d UTSW 1 87,627,397 (GRCm39) missense probably damaging 1.00
R6526:Inpp5d UTSW 1 87,603,972 (GRCm39) start gained probably benign
R6572:Inpp5d UTSW 1 87,623,118 (GRCm39) missense probably damaging 0.99
R6831:Inpp5d UTSW 1 87,629,198 (GRCm39) nonsense probably null
R6853:Inpp5d UTSW 1 87,609,402 (GRCm39) splice site probably null
R6883:Inpp5d UTSW 1 87,627,412 (GRCm39) missense probably damaging 0.98
R7082:Inpp5d UTSW 1 87,623,102 (GRCm39) missense probably damaging 0.99
R7215:Inpp5d UTSW 1 87,628,940 (GRCm39) missense probably benign 0.30
R7418:Inpp5d UTSW 1 87,635,933 (GRCm39) critical splice donor site probably null
R7471:Inpp5d UTSW 1 87,623,122 (GRCm39) missense probably damaging 1.00
R7593:Inpp5d UTSW 1 87,645,500 (GRCm39) missense possibly damaging 0.82
R7716:Inpp5d UTSW 1 87,593,121 (GRCm39) missense probably damaging 0.97
R7781:Inpp5d UTSW 1 87,627,394 (GRCm39) missense probably damaging 1.00
R7808:Inpp5d UTSW 1 87,611,567 (GRCm39) nonsense probably null
R7920:Inpp5d UTSW 1 87,633,671 (GRCm39) missense probably damaging 1.00
R8788:Inpp5d UTSW 1 87,611,484 (GRCm39) missense probably damaging 1.00
R8839:Inpp5d UTSW 1 87,619,433 (GRCm39) missense probably damaging 0.97
R8905:Inpp5d UTSW 1 87,637,348 (GRCm39) missense probably damaging 0.99
R8906:Inpp5d UTSW 1 87,625,337 (GRCm39) intron probably benign
R9517:Inpp5d UTSW 1 87,638,853 (GRCm39) missense probably benign 0.01
R9667:Inpp5d UTSW 1 87,623,128 (GRCm39) missense probably damaging 1.00
R9716:Inpp5d UTSW 1 87,625,191 (GRCm39) missense possibly damaging 0.90
Z1176:Inpp5d UTSW 1 87,630,853 (GRCm39) missense probably damaging 1.00
Z1176:Inpp5d UTSW 1 87,597,431 (GRCm39) missense probably benign 0.16
Z1191:Inpp5d UTSW 1 87,611,492 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AATCTCATCACCCAGCATCGTG -3'
(R):5'- CAGCTCAACATACCTGCATGG -3'

Sequencing Primer
(F):5'- GCATCGTGCTCCCCAAAG -3'
(R):5'- AAGCAGCCCCTCCTCTTGG -3'
Posted On 2016-09-01