Incidental Mutation 'R5156:Muc19'
ID 396750
Institutional Source Beutler Lab
Gene Symbol Muc19
Ensembl Gene ENSMUSG00000044021
Gene Name mucin 19
Synonyms sld, apomucin
MMRRC Submission 042738-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R5156 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 91722531-91832440 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) T to A at 91784614 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160242
SMART Domains Protein: ENSMUSP00000125205
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 21 34 N/A INTRINSIC
VWD 47 198 1.31e-13 SMART
Pfam:C8 221 293 1.1e-8 PFAM
Pfam:TIL 298 353 1.6e-11 PFAM
VWD 383 545 1.58e-25 SMART
C8 577 651 8.71e-20 SMART
Pfam:TIL 654 711 2.1e-7 PFAM
Pfam:TIL 753 813 5.2e-8 PFAM
VWD 842 1005 2.36e-47 SMART
C8 1041 1115 1.84e-27 SMART
low complexity region 1220 1254 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180042
SMART Domains Protein: ENSMUSP00000136207
Gene: ENSMUSG00000044021

DomainStartEndE-ValueType
C8 17 91 8.71e-20 SMART
Pfam:TIL 94 151 1.2e-7 PFAM
Pfam:TIL 193 253 6.6e-8 PFAM
VWD 282 445 2.36e-47 SMART
C8 481 555 1.84e-27 SMART
low complexity region 660 701 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 100% (52/52)
MGI Phenotype PHENOTYPE: Mice homozygous for this spontaneous mutation show a partially arrested mucous cell differentiation of the sublingual glands. Severe inflammatory lesions resembling Sjogren's syndrome develop spontaneously in salivary and lacrimal glands of neonatally thymectomized mutants without any immunization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921513D11Rik G T 17: 79,935,638 (GRCm39) probably benign Het
Apeh C T 9: 107,971,486 (GRCm39) A29T probably damaging Het
Arap2 A T 5: 62,826,524 (GRCm39) Y1013* probably null Het
Arhgef4 A G 1: 34,762,355 (GRCm39) E537G unknown Het
Asf1b T C 8: 84,682,540 (GRCm39) F28S probably damaging Het
Cd46 T A 1: 194,767,693 (GRCm39) I123L possibly damaging Het
Cdca7 A T 2: 72,309,370 (GRCm39) T48S probably damaging Het
Cfap53 T A 18: 74,492,838 (GRCm39) probably benign Het
Clca3a2 T A 3: 144,511,599 (GRCm39) T599S probably benign Het
Csf1 T A 3: 107,656,252 (GRCm39) T148S probably benign Het
Dmbt1 T C 7: 130,699,400 (GRCm39) probably null Het
Dmpk A G 7: 18,818,050 (GRCm39) D44G probably damaging Het
Dnajb12 T A 10: 59,728,782 (GRCm39) N223K probably damaging Het
Dync1h1 T A 12: 110,595,264 (GRCm39) M1392K probably benign Het
Edrf1 C T 7: 133,261,908 (GRCm39) A867V probably damaging Het
Efemp2 T A 19: 5,527,706 (GRCm39) C94S possibly damaging Het
Epha8 C T 4: 136,666,037 (GRCm39) S373N probably benign Het
Foxk1 A G 5: 142,434,588 (GRCm39) D284G possibly damaging Het
Fzd10 C A 5: 128,678,366 (GRCm39) R29S possibly damaging Het
Gm13991 T C 2: 116,358,665 (GRCm39) noncoding transcript Het
Gm6818 A T 7: 38,101,471 (GRCm39) noncoding transcript Het
Hydin T A 8: 111,336,333 (GRCm39) C5037S probably benign Het
Ikzf1 T A 11: 11,719,448 (GRCm39) M492K probably damaging Het
Krt20 G T 11: 99,320,879 (GRCm39) S394R possibly damaging Het
Lrrc71 T A 3: 87,653,094 (GRCm39) R107S probably benign Het
Mia2 A G 12: 59,219,323 (GRCm39) T436A possibly damaging Het
Neu4 T C 1: 93,952,177 (GRCm39) V182A probably damaging Het
Notch2 T G 3: 98,031,626 (GRCm39) F1167V possibly damaging Het
Nrap A G 19: 56,360,277 (GRCm39) M189T possibly damaging Het
Nt5m A T 11: 59,765,487 (GRCm39) I172F probably damaging Het
Or5b118 G T 19: 13,449,037 (GRCm39) K234N probably damaging Het
Or5w15 G A 2: 87,568,119 (GRCm39) P183L possibly damaging Het
Or8k41 A T 2: 86,313,362 (GRCm39) C241* probably null Het
Plekha5 C T 6: 140,372,254 (GRCm39) T68M probably damaging Het
Ppef2 A G 5: 92,392,461 (GRCm39) probably null Het
Ppp1r37 T C 7: 19,295,900 (GRCm39) probably benign Het
Rfx4 T C 10: 84,704,218 (GRCm39) Y238H probably damaging Het
Sanbr A G 11: 23,543,424 (GRCm39) probably null Het
Sec13 G A 6: 113,707,837 (GRCm39) A161V probably benign Het
Serhl G A 15: 82,986,895 (GRCm39) probably benign Het
Slco4a1 T C 2: 180,114,572 (GRCm39) V588A probably benign Het
Slitrk3 T C 3: 72,956,592 (GRCm39) T727A probably benign Het
Sp100 T A 1: 85,601,404 (GRCm39) D241E probably damaging Het
Spata2 G T 2: 167,325,494 (GRCm39) H442N probably damaging Het
Speg T C 1: 75,404,731 (GRCm39) V2588A probably damaging Het
Tnfsf12 A G 11: 69,578,155 (GRCm39) S141P probably damaging Het
Trank1 A G 9: 111,219,762 (GRCm39) I2166M probably damaging Het
Trim10 T A 17: 37,187,948 (GRCm39) V388E probably damaging Het
Ttc23l G T 15: 10,551,636 (GRCm39) T30K possibly damaging Het
Vmn2r10 A G 5: 109,143,466 (GRCm39) V828A probably benign Het
Vmn2r75 T A 7: 85,813,436 (GRCm39) L455F possibly damaging Het
Vwa8 T A 14: 79,221,666 (GRCm39) S541T probably benign Het
Other mutations in Muc19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Muc19 APN 15 91,770,943 (GRCm39) exon noncoding transcript
IGL01017:Muc19 APN 15 91,764,901 (GRCm39) exon noncoding transcript
IGL01140:Muc19 APN 15 91,783,593 (GRCm39) exon noncoding transcript
IGL01292:Muc19 APN 15 91,778,470 (GRCm39) exon noncoding transcript
IGL01397:Muc19 APN 15 91,778,498 (GRCm39) exon noncoding transcript
IGL01525:Muc19 APN 15 91,770,877 (GRCm39) exon noncoding transcript
IGL01589:Muc19 APN 15 91,754,699 (GRCm39) exon noncoding transcript
IGL02023:Muc19 APN 15 91,772,453 (GRCm39) exon noncoding transcript
IGL02088:Muc19 APN 15 91,775,362 (GRCm39) splice site noncoding transcript
IGL02168:Muc19 APN 15 91,778,292 (GRCm39) exon noncoding transcript
IGL02343:Muc19 APN 15 91,778,428 (GRCm39) exon noncoding transcript
IGL02402:Muc19 APN 15 91,778,192 (GRCm39) splice site noncoding transcript
IGL02433:Muc19 APN 15 91,756,694 (GRCm39) exon noncoding transcript
IGL02533:Muc19 APN 15 91,782,241 (GRCm39) exon noncoding transcript
IGL02558:Muc19 APN 15 91,781,816 (GRCm39) exon noncoding transcript
IGL02652:Muc19 APN 15 91,762,009 (GRCm39) critical splice donor site noncoding transcript
IGL03032:Muc19 APN 15 91,808,424 (GRCm39) unclassified noncoding transcript
IGL02837:Muc19 UTSW 15 91,766,850 (GRCm39) exon noncoding transcript
R0098:Muc19 UTSW 15 91,777,101 (GRCm39) exon noncoding transcript
R0098:Muc19 UTSW 15 91,777,101 (GRCm39) exon noncoding transcript
R0208:Muc19 UTSW 15 91,777,218 (GRCm39) splice site noncoding transcript
R0597:Muc19 UTSW 15 91,784,696 (GRCm39) splice site noncoding transcript
R1185:Muc19 UTSW 15 91,762,743 (GRCm39) exon noncoding transcript
R1185:Muc19 UTSW 15 91,762,743 (GRCm39) exon noncoding transcript
R1469:Muc19 UTSW 15 91,758,498 (GRCm39) unclassified noncoding transcript
R1942:Muc19 UTSW 15 91,776,666 (GRCm39) exon noncoding transcript
R2035:Muc19 UTSW 15 91,776,599 (GRCm39) splice site noncoding transcript
R2208:Muc19 UTSW 15 91,755,747 (GRCm39) exon noncoding transcript
R2877:Muc19 UTSW 15 91,777,200 (GRCm39) exon noncoding transcript
R2897:Muc19 UTSW 15 91,822,550 (GRCm39) critical splice donor site noncoding transcript
R4110:Muc19 UTSW 15 91,781,816 (GRCm39) exon noncoding transcript
R4403:Muc19 UTSW 15 91,755,768 (GRCm39) exon noncoding transcript
R4606:Muc19 UTSW 15 91,832,268 (GRCm39) exon noncoding transcript
R4677:Muc19 UTSW 15 91,772,411 (GRCm39) exon noncoding transcript
R4753:Muc19 UTSW 15 91,761,955 (GRCm39) unclassified noncoding transcript
R4781:Muc19 UTSW 15 91,787,360 (GRCm39) critical splice donor site noncoding transcript
R4869:Muc19 UTSW 15 91,781,910 (GRCm39) exon noncoding transcript
R5000:Muc19 UTSW 15 91,757,429 (GRCm39) unclassified noncoding transcript
R5044:Muc19 UTSW 15 91,772,332 (GRCm39) exon noncoding transcript
R5176:Muc19 UTSW 15 91,776,374 (GRCm39) exon noncoding transcript
R5224:Muc19 UTSW 15 91,825,910 (GRCm39) exon noncoding transcript
R5524:Muc19 UTSW 15 91,778,587 (GRCm39) exon noncoding transcript
R5568:Muc19 UTSW 15 91,768,468 (GRCm39) splice site noncoding transcript
R5592:Muc19 UTSW 15 91,828,199 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- GTGATGTCTTGCTACACTCCAC -3'
(R):5'- CATCATCGAAAGCCTGCAAG -3'

Sequencing Primer
(F):5'- CCTCAGCTAACAGAATTATTGCAG -3'
(R):5'- AGTAGCACAGAGCATACC -3'
Posted On 2016-06-21