Mutagenetix > Incidental Mutation

Incidental Mutation 'R5046:Gal'

394398

Institutional Source

Beutler Lab

Gene Symbol

Gal

Ensembl Gene

ENSMUSG00000024907

Gene Name

galanin and GMAP prepropeptide

Synonyms

Galn

MMRRC Submission

042636-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

3459915-3464544 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 3461167 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 89 (R89H)

Ref Sequence

ENSEMBL: ENSMUSP00000025842 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025840] [ENSMUST00000025842] [ENSMUST00000127142] [ENSMUST00000142193]

AlphaFold

P47212

Predicted Effect

probably benign
Transcript: ENSMUST00000025840

SMART Domains

Protein: ENSMUSP00000025840
Gene: ENSMUSG00000024905

Domain	Start	End	E-Value	Type
low complexity region	91	99	N/A	INTRINSIC
low complexity region	107	123	N/A	INTRINSIC
Blast:CXC	246	287	4e-13	BLAST
CXC	332	373	1.37e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000025842
AA Change: R89H

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000025842
Gene: ENSMUSG00000024907
AA Change: R89H

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
Galanin	20	124	3.41e-68	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000127142

SMART Domains

Protein: ENSMUSP00000122687
Gene: ENSMUSG00000024905

Domain	Start	End	E-Value	Type
Blast:CXC	67	107	1e-13	BLAST
CXC	152	193	1.37e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000142193

SMART Domains

Protein: ENSMUSP00000114171
Gene: ENSMUSG00000024905

Domain	Start	End	E-Value	Type
Blast:CXC	67	107	1e-13	BLAST
CXC	152	193	1.37e-17	SMART

Meta Mutation Damage Score

0.4159

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: This gene encodes a neuroendocrine peptide that is principally produced by a subpopulation of lactotrophs in the pituitary gland. The encoded protein is a precursor that is proteolytically processed to generate two mature peptides: galanin and galanin message-associated peptide (GMAP). Mice lacking the encoded protein fail to lactate sufficiently due to abnormalities in the expression of prolactin and lactotroph proliferation, exhibit attenuated chronic neuropathic pain and developmental deficits in the dorsal root ganglion neurons. This gene encodes distinct isoforms, some or all of which may undergo similar processing to generate the mature proteins. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous inactivation of this gene leads to alterations in neuroendocrine homeostasis, prolactin release, lactotroph number, mammary gland maturation, lactation, susceptibility to neuronal excitotoxicity and induced seizures, sensory neuron developmentand regeneration, and long term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm4	C	A	7: 119,302,597 (GRCm39)	H241N	probably damaging	Het
Arhgap32	G	A	9: 32,168,095 (GRCm39)	A693T	probably damaging	Het
B4galnt3	G	T	6: 120,191,759 (GRCm39)	A658D	probably damaging	Het
Car12	G	A	9: 66,653,895 (GRCm39)	E84K	probably benign	Het
Crocc2	T	A	1: 93,133,624 (GRCm39)	S969T	probably damaging	Het
Crym	A	G	7: 119,794,667 (GRCm39)	V184A	possibly damaging	Het
Cryzl2	T	C	1: 157,292,583 (GRCm39)	C122R	probably damaging	Het
Defb30	T	C	14: 63,273,463 (GRCm39)	E49G	probably benign	Het
Dnah3	A	G	7: 119,550,803 (GRCm39)	L3161P	probably damaging	Het
Dnajc5g	A	G	5: 31,267,036 (GRCm39)	N104S	probably benign	Het
Fcgr1	T	G	3: 96,194,302 (GRCm39)	K195T	probably damaging	Het
Gcfc2	C	T	6: 81,925,316 (GRCm39)	A577V	probably benign	Het
Gm5116	A	C	7: 32,195,379 (GRCm39)		noncoding transcript	Het
Golga3	A	T	5: 110,340,806 (GRCm39)	Q540L	probably damaging	Het
Hectd1	T	C	12: 51,797,171 (GRCm39)	E2184G	probably damaging	Het
Hspa12a	T	C	19: 58,787,977 (GRCm39)	D615G	probably damaging	Het
Igkv14-130	A	T	6: 67,768,465 (GRCm39)	Y107F	probably damaging	Het
Ldlr	T	A	9: 21,657,203 (GRCm39)		probably null	Het
Lin9	T	A	1: 180,496,763 (GRCm39)	L351I	probably benign	Het
Lrrc37a	A	T	11: 103,389,066 (GRCm39)	S2120T	unknown	Het
Mtfmt	G	T	9: 65,346,897 (GRCm39)	V164F	probably damaging	Het
Nampt	T	C	12: 32,883,037 (GRCm39)	V74A	probably damaging	Het
Ndufc2	G	T	7: 97,056,871 (GRCm39)	R120L	probably damaging	Het
Neo1	A	T	9: 58,801,194 (GRCm39)	V1156D	possibly damaging	Het
Nlrp1b	G	A	11: 71,050,898 (GRCm39)	P1065S	possibly damaging	Het
Nop9	A	G	14: 55,983,397 (GRCm39)	H56R	possibly damaging	Het
Or4k41	A	T	2: 111,279,934 (GRCm39)	T150S	probably benign	Het
Or6c75	A	T	10: 129,337,178 (GRCm39)	M142L	possibly damaging	Het
Pign	A	T	1: 105,449,798 (GRCm39)	N909K	possibly damaging	Het
Prex1	A	G	2: 166,414,883 (GRCm39)	V304A	probably benign	Het
Racgap1	G	A	15: 99,526,643 (GRCm39)	R307W	probably damaging	Het
Rap1gds1	C	A	3: 138,661,181 (GRCm39)	E399*	probably null	Het
Rwdd4a	G	A	8: 47,995,837 (GRCm39)		probably null	Het
Sanbr	A	C	11: 23,570,354 (GRCm39)	M182R	probably benign	Het
Scp2	T	C	4: 107,928,488 (GRCm39)	T401A	probably benign	Het
Sdha	A	G	13: 74,475,452 (GRCm39)	F526S	probably damaging	Het
Shroom1	T	A	11: 53,354,872 (GRCm39)	L264Q	probably benign	Het
Sorl1	T	C	9: 41,907,590 (GRCm39)	T1466A	probably benign	Het
Trpm2	C	T	10: 77,801,852 (GRCm39)	C71Y	probably damaging	Het
Ugt2b34	G	A	5: 87,052,246 (GRCm39)	S250L	probably benign	Het
Vmn2r88	A	G	14: 51,650,638 (GRCm39)	D117G	probably benign	Het
Wdr73	A	T	7: 80,542,173 (GRCm39)		probably benign	Het

Other mutations in Gal

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00922:Gal	APN	19	3,461,575 (GRCm39)	missense	probably benign	0.02
R0385:Gal	UTSW	19	3,461,171 (GRCm39)	missense	probably benign	0.13
R3605:Gal	UTSW	19	3,464,026 (GRCm39)	splice site	probably null
R4817:Gal	UTSW	19	3,461,126 (GRCm39)	splice site	probably null
R4911:Gal	UTSW	19	3,461,590 (GRCm39)	missense	probably benign	0.15
R5921:Gal	UTSW	19	3,460,100 (GRCm39)	missense	probably damaging	0.99
R6660:Gal	UTSW	19	3,460,108 (GRCm39)	missense	possibly damaging	0.52
R7658:Gal	UTSW	19	3,463,309 (GRCm39)	missense	probably damaging	1.00
X0065:Gal	UTSW	19	3,461,181 (GRCm39)	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- TCGAGTGTGACTAGCCTCAGTC -3'
(R):5'- GGCATGCACCTACAACAAGG -3'

Sequencing Primer
(F):5'- GAGTGTGACTAGCCTCAGTCCTAAC -3'
(R):5'- ACCTACAACAAGGGGCCTGG -3'

Posted On

2016-06-15