Mutagenetix > Incidental Mutation

Incidental Mutation 'R5046:Arhgap32'

394378

Institutional Source

Beutler Lab

Gene Symbol

Arhgap32

Ensembl Gene

ENSMUSG00000041444

Gene Name

Rho GTPase activating protein 32

Synonyms

p200RhoGAP, Grit, PX-RICS, GC-GAP, 3426406O18Rik

MMRRC Submission

042636-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5046 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

32027432-32179742 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 32168095 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 693 (A693T)

Ref Sequence

ENSEMBL: ENSMUSP00000138145 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000168954] [ENSMUST00000174641] [ENSMUST00000182802]

AlphaFold

Q811P8

Predicted Effect

probably damaging
Transcript: ENSMUST00000168954
AA Change: A693T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128448
Gene: ENSMUSG00000041444
AA Change: A693T

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174641
AA Change: A1042T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133898
Gene: ENSMUSG00000041444
AA Change: A1042T

Domain	Start	End	E-Value	Type
Pfam:PX	132	226	5.6e-7	PFAM
SH3	262	320	7.4e-11	SMART
RhoGAP	383	564	9.6e-60	SMART
Blast:RhoGAP	581	647	9e-31	BLAST
low complexity region	867	882	N/A	INTRINSIC
low complexity region	1018	1038	N/A	INTRINSIC
low complexity region	1045	1059	N/A	INTRINSIC
low complexity region	1262	1275	N/A	INTRINSIC
low complexity region	1309	1323	N/A	INTRINSIC
low complexity region	1346	1357	N/A	INTRINSIC
low complexity region	1425	1442	N/A	INTRINSIC
low complexity region	1653	1666	N/A	INTRINSIC
low complexity region	2040	2049	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000182802
AA Change: A693T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000138145
Gene: ENSMUSG00000041444
AA Change: A693T

Domain	Start	End	E-Value	Type
RhoGAP	34	215	9.6e-60	SMART
Blast:RhoGAP	232	298	7e-31	BLAST
low complexity region	518	533	N/A	INTRINSIC
low complexity region	669	689	N/A	INTRINSIC
low complexity region	696	710	N/A	INTRINSIC
low complexity region	913	926	N/A	INTRINSIC
low complexity region	960	974	N/A	INTRINSIC
low complexity region	997	1008	N/A	INTRINSIC
low complexity region	1076	1093	N/A	INTRINSIC
low complexity region	1304	1317	N/A	INTRINSIC
low complexity region	1691	1700	N/A	INTRINSIC

Meta Mutation Damage Score

0.1301

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

100% (52/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICS is a neuron-associated GTPase-activating protein that may regulate dendritic spine morphology and strength by modulating Rho GTPase (see RHOA; MIM 165390) activity (Okabe et al., 2003 [PubMed 12531901]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null mutation are fertile but display abnormal neurite growth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsm4	C	A	7: 119,302,597 (GRCm39)	H241N	probably damaging	Het
B4galnt3	G	T	6: 120,191,759 (GRCm39)	A658D	probably damaging	Het
Car12	G	A	9: 66,653,895 (GRCm39)	E84K	probably benign	Het
Crocc2	T	A	1: 93,133,624 (GRCm39)	S969T	probably damaging	Het
Crym	A	G	7: 119,794,667 (GRCm39)	V184A	possibly damaging	Het
Cryzl2	T	C	1: 157,292,583 (GRCm39)	C122R	probably damaging	Het
Defb30	T	C	14: 63,273,463 (GRCm39)	E49G	probably benign	Het
Dnah3	A	G	7: 119,550,803 (GRCm39)	L3161P	probably damaging	Het
Dnajc5g	A	G	5: 31,267,036 (GRCm39)	N104S	probably benign	Het
Fcgr1	T	G	3: 96,194,302 (GRCm39)	K195T	probably damaging	Het
Gal	C	T	19: 3,461,167 (GRCm39)	R89H	probably damaging	Het
Gcfc2	C	T	6: 81,925,316 (GRCm39)	A577V	probably benign	Het
Gm5116	A	C	7: 32,195,379 (GRCm39)		noncoding transcript	Het
Golga3	A	T	5: 110,340,806 (GRCm39)	Q540L	probably damaging	Het
Hectd1	T	C	12: 51,797,171 (GRCm39)	E2184G	probably damaging	Het
Hspa12a	T	C	19: 58,787,977 (GRCm39)	D615G	probably damaging	Het
Igkv14-130	A	T	6: 67,768,465 (GRCm39)	Y107F	probably damaging	Het
Ldlr	T	A	9: 21,657,203 (GRCm39)		probably null	Het
Lin9	T	A	1: 180,496,763 (GRCm39)	L351I	probably benign	Het
Lrrc37a	A	T	11: 103,389,066 (GRCm39)	S2120T	unknown	Het
Mtfmt	G	T	9: 65,346,897 (GRCm39)	V164F	probably damaging	Het
Nampt	T	C	12: 32,883,037 (GRCm39)	V74A	probably damaging	Het
Ndufc2	G	T	7: 97,056,871 (GRCm39)	R120L	probably damaging	Het
Neo1	A	T	9: 58,801,194 (GRCm39)	V1156D	possibly damaging	Het
Nlrp1b	G	A	11: 71,050,898 (GRCm39)	P1065S	possibly damaging	Het
Nop9	A	G	14: 55,983,397 (GRCm39)	H56R	possibly damaging	Het
Or4k41	A	T	2: 111,279,934 (GRCm39)	T150S	probably benign	Het
Or6c75	A	T	10: 129,337,178 (GRCm39)	M142L	possibly damaging	Het
Pign	A	T	1: 105,449,798 (GRCm39)	N909K	possibly damaging	Het
Prex1	A	G	2: 166,414,883 (GRCm39)	V304A	probably benign	Het
Racgap1	G	A	15: 99,526,643 (GRCm39)	R307W	probably damaging	Het
Rap1gds1	C	A	3: 138,661,181 (GRCm39)	E399*	probably null	Het
Rwdd4a	G	A	8: 47,995,837 (GRCm39)		probably null	Het
Sanbr	A	C	11: 23,570,354 (GRCm39)	M182R	probably benign	Het
Scp2	T	C	4: 107,928,488 (GRCm39)	T401A	probably benign	Het
Sdha	A	G	13: 74,475,452 (GRCm39)	F526S	probably damaging	Het
Shroom1	T	A	11: 53,354,872 (GRCm39)	L264Q	probably benign	Het
Sorl1	T	C	9: 41,907,590 (GRCm39)	T1466A	probably benign	Het
Trpm2	C	T	10: 77,801,852 (GRCm39)	C71Y	probably damaging	Het
Ugt2b34	G	A	5: 87,052,246 (GRCm39)	S250L	probably benign	Het
Vmn2r88	A	G	14: 51,650,638 (GRCm39)	D117G	probably benign	Het
Wdr73	A	T	7: 80,542,173 (GRCm39)		probably benign	Het

Other mutations in Arhgap32

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01020:Arhgap32	APN	9	32,168,657 (GRCm39)	missense	probably benign	0.00
IGL01317:Arhgap32	APN	9	32,168,260 (GRCm39)	missense	probably benign	0.30
IGL01614:Arhgap32	APN	9	32,171,801 (GRCm39)	missense	probably damaging	1.00
IGL01791:Arhgap32	APN	9	32,158,486 (GRCm39)	missense	probably damaging	0.96
IGL02318:Arhgap32	APN	9	32,170,627 (GRCm39)	missense	probably benign	0.00
IGL02542:Arhgap32	APN	9	32,166,944 (GRCm39)	missense	probably damaging	1.00
IGL02568:Arhgap32	APN	9	32,158,490 (GRCm39)	missense	probably damaging	1.00
IGL02627:Arhgap32	APN	9	32,157,302 (GRCm39)	missense	probably damaging	1.00
IGL02927:Arhgap32	APN	9	32,172,431 (GRCm39)	missense	possibly damaging	0.95
IGL03157:Arhgap32	APN	9	32,170,430 (GRCm39)	missense	probably damaging	1.00
IGL03286:Arhgap32	APN	9	32,170,816 (GRCm39)	missense	probably benign	0.06
PIT4445001:Arhgap32	UTSW	9	32,172,152 (GRCm39)	missense	probably damaging	1.00
R0004:Arhgap32	UTSW	9	32,063,294 (GRCm39)	missense	probably damaging	0.98
R0335:Arhgap32	UTSW	9	32,171,056 (GRCm39)	missense	probably benign	0.00
R0380:Arhgap32	UTSW	9	32,157,773 (GRCm39)	missense	probably damaging	1.00
R0396:Arhgap32	UTSW	9	32,156,551 (GRCm39)	critical splice donor site	probably null
R0494:Arhgap32	UTSW	9	32,170,199 (GRCm39)	missense	probably damaging	0.98
R0508:Arhgap32	UTSW	9	32,101,364 (GRCm39)	splice site	probably benign
R0856:Arhgap32	UTSW	9	32,171,516 (GRCm39)	missense	probably damaging	1.00
R0990:Arhgap32	UTSW	9	32,166,677 (GRCm39)	missense	probably damaging	1.00
R1312:Arhgap32	UTSW	9	32,166,608 (GRCm39)	missense	probably benign
R1455:Arhgap32	UTSW	9	32,171,381 (GRCm39)	missense	probably benign	0.08
R1515:Arhgap32	UTSW	9	32,027,498 (GRCm39)	missense	probably benign
R1523:Arhgap32	UTSW	9	32,168,048 (GRCm39)	missense	probably damaging	1.00
R1651:Arhgap32	UTSW	9	32,171,096 (GRCm39)	missense	probably damaging	1.00
R1743:Arhgap32	UTSW	9	32,170,727 (GRCm39)	missense	probably benign	0.00
R1999:Arhgap32	UTSW	9	32,027,436 (GRCm39)	missense	possibly damaging	0.52
R2098:Arhgap32	UTSW	9	32,171,207 (GRCm39)	missense	probably damaging	1.00
R2150:Arhgap32	UTSW	9	32,027,436 (GRCm39)	missense	possibly damaging	0.52
R2256:Arhgap32	UTSW	9	32,158,793 (GRCm39)	missense	probably damaging	0.99
R2257:Arhgap32	UTSW	9	32,158,793 (GRCm39)	missense	probably damaging	0.99
R2989:Arhgap32	UTSW	9	32,150,694 (GRCm39)	missense	possibly damaging	0.54
R3780:Arhgap32	UTSW	9	32,063,315 (GRCm39)	splice site	probably null
R3793:Arhgap32	UTSW	9	32,166,669 (GRCm39)	missense	probably damaging	1.00
R3846:Arhgap32	UTSW	9	32,101,320 (GRCm39)	missense	probably benign	0.03
R4086:Arhgap32	UTSW	9	32,158,362 (GRCm39)	unclassified	probably benign
R4177:Arhgap32	UTSW	9	32,158,510 (GRCm39)	missense	probably null	1.00
R4230:Arhgap32	UTSW	9	32,168,770 (GRCm39)	missense	probably benign	0.10
R4280:Arhgap32	UTSW	9	32,171,185 (GRCm39)	missense	probably damaging	0.98
R4504:Arhgap32	UTSW	9	32,093,135 (GRCm39)	splice site	probably null
R4587:Arhgap32	UTSW	9	32,172,241 (GRCm39)	missense	probably benign	0.02
R4612:Arhgap32	UTSW	9	32,170,775 (GRCm39)	missense	probably damaging	0.99
R4622:Arhgap32	UTSW	9	32,150,644 (GRCm39)	missense	possibly damaging	0.75
R4670:Arhgap32	UTSW	9	32,081,441 (GRCm39)	missense	probably benign	0.03
R4784:Arhgap32	UTSW	9	32,172,076 (GRCm39)	missense	probably damaging	1.00
R4784:Arhgap32	UTSW	9	32,040,949 (GRCm39)	missense	probably damaging	0.99
R4785:Arhgap32	UTSW	9	32,040,949 (GRCm39)	missense	probably damaging	0.99
R4785:Arhgap32	UTSW	9	32,172,076 (GRCm39)	missense	probably damaging	1.00
R4906:Arhgap32	UTSW	9	32,156,552 (GRCm39)	critical splice donor site	probably null
R5360:Arhgap32	UTSW	9	32,170,967 (GRCm39)	missense	probably damaging	1.00
R5382:Arhgap32	UTSW	9	32,063,306 (GRCm39)	missense	probably damaging	1.00
R5445:Arhgap32	UTSW	9	32,159,678 (GRCm39)	missense	probably benign	0.19
R5637:Arhgap32	UTSW	9	32,158,502 (GRCm39)	missense	probably damaging	1.00
R5659:Arhgap32	UTSW	9	32,093,256 (GRCm39)	missense	probably damaging	1.00
R5801:Arhgap32	UTSW	9	32,167,084 (GRCm39)	missense	probably benign	0.01
R6002:Arhgap32	UTSW	9	32,168,275 (GRCm39)	missense	probably benign	0.00
R6109:Arhgap32	UTSW	9	32,171,407 (GRCm39)	missense	probably damaging	1.00
R6405:Arhgap32	UTSW	9	32,159,784 (GRCm39)	missense	probably benign	0.31
R6922:Arhgap32	UTSW	9	32,063,983 (GRCm39)	missense	possibly damaging	0.86
R7009:Arhgap32	UTSW	9	32,157,272 (GRCm39)	missense	probably damaging	1.00
R7137:Arhgap32	UTSW	9	32,063,232 (GRCm39)	missense	probably benign	0.32
R7183:Arhgap32	UTSW	9	32,097,679 (GRCm39)	missense	probably benign	0.15
R7251:Arhgap32	UTSW	9	32,119,481 (GRCm39)	missense	probably damaging	1.00
R7287:Arhgap32	UTSW	9	32,063,993 (GRCm39)	missense
R7289:Arhgap32	UTSW	9	32,168,234 (GRCm39)	missense	probably benign	0.02
R7289:Arhgap32	UTSW	9	32,168,233 (GRCm39)	missense	possibly damaging	0.92
R7391:Arhgap32	UTSW	9	32,093,235 (GRCm39)	missense	probably benign	0.00
R7408:Arhgap32	UTSW	9	32,157,220 (GRCm39)	missense	probably benign	0.06
R7566:Arhgap32	UTSW	9	32,162,018 (GRCm39)	missense	probably benign	0.10
R7584:Arhgap32	UTSW	9	32,168,263 (GRCm39)	missense	probably benign	0.16
R7653:Arhgap32	UTSW	9	32,168,441 (GRCm39)	missense	probably benign
R7884:Arhgap32	UTSW	9	32,171,810 (GRCm39)	missense	possibly damaging	0.87
R8087:Arhgap32	UTSW	9	32,168,324 (GRCm39)	missense	probably benign	0.00
R8109:Arhgap32	UTSW	9	32,093,150 (GRCm39)	missense	probably benign	0.09
R8131:Arhgap32	UTSW	9	32,158,426 (GRCm39)	missense	probably damaging	1.00
R8155:Arhgap32	UTSW	9	32,093,196 (GRCm39)	missense	probably damaging	1.00
R8232:Arhgap32	UTSW	9	32,168,198 (GRCm39)	missense	probably damaging	1.00
R8303:Arhgap32	UTSW	9	32,172,205 (GRCm39)	missense	probably benign	0.00
R8304:Arhgap32	UTSW	9	32,167,233 (GRCm39)	nonsense	probably null
R8696:Arhgap32	UTSW	9	32,159,799 (GRCm39)	missense	possibly damaging	0.90
R8832:Arhgap32	UTSW	9	32,172,115 (GRCm39)	missense	possibly damaging	0.94
R9112:Arhgap32	UTSW	9	32,157,309 (GRCm39)	missense	probably damaging	0.99
R9170:Arhgap32	UTSW	9	32,162,039 (GRCm39)	missense	possibly damaging	0.47
R9279:Arhgap32	UTSW	9	32,168,655 (GRCm39)	missense	probably benign	0.01
R9431:Arhgap32	UTSW	9	32,170,463 (GRCm39)	missense	probably damaging	1.00
R9522:Arhgap32	UTSW	9	32,027,450 (GRCm39)	missense	probably benign
R9526:Arhgap32	UTSW	9	32,172,026 (GRCm39)	missense	probably benign	0.28
R9661:Arhgap32	UTSW	9	32,168,531 (GRCm39)	missense	probably benign	0.01
X0027:Arhgap32	UTSW	9	32,161,937 (GRCm39)	critical splice acceptor site	probably null
X0063:Arhgap32	UTSW	9	32,172,365 (GRCm39)	missense	probably damaging	1.00
Z1177:Arhgap32	UTSW	9	32,171,976 (GRCm39)	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- CAGCATTTGCATGTGGGATAG -3'
(R):5'- TCCGAGTCCATTGATCTGCG -3'

Sequencing Primer
(F):5'- CATTTGCATGTGGGATAGAAGATC -3'
(R):5'- CCATTGATCTGCGGGTGGAAC -3'

Posted On

2016-06-15