Mutagenetix > Incidental Mutation

Incidental Mutation 'IGL03046:Pkhd1'

391836

Institutional Source

Beutler Lab

Gene Symbol

Pkhd1

Ensembl Gene

ENSMUSG00000043760

Gene Name

polycystic kidney and hepatic disease 1

Synonyms

FPC, tigmin

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

IGL03046 (G1)

Quality Score

201

Status

Validated

Chromosome

Chromosomal Location

20128003-20688288 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 20607589 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 1089 (D1089A)

Ref Sequence

ENSEMBL: ENSMUSP00000085794 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088448]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000088448
AA Change: D1089A

PolyPhen 2 Score 0.807 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000085794
Gene: ENSMUSG00000043760
AA Change: D1089A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Blast:IPT	134	254	1e-45	BLAST
IPT	256	353	1.13e-3	SMART
low complexity region	722	743	N/A	INTRINSIC
low complexity region	896	909	N/A	INTRINSIC
Pfam:TIG	936	1005	9.1e-8	PFAM
IPT	1016	1101	1.18e-6	SMART
IPT	1105	1190	1.27e0	SMART
IPT	1193	1290	7.05e-5	SMART
IPT	1384	1467	1.36e1	SMART
IPT	1568	1655	2.4e0	SMART
low complexity region	1881	1892	N/A	INTRINSIC
G8	1928	2049	1.15e-48	SMART
low complexity region	2079	2094	N/A	INTRINSIC
PbH1	2244	2266	7.82e3	SMART
PbH1	2287	2321	2.23e3	SMART
PbH1	2404	2426	7.19e2	SMART
PbH1	2459	2481	2.64e2	SMART
low complexity region	2713	2728	N/A	INTRINSIC
G8	2734	2867	1.73e-43	SMART
Blast:G8	2876	2923	2e-17	BLAST
PbH1	3004	3026	3.98e3	SMART
PbH1	3027	3049	1.27e0	SMART
PbH1	3080	3102	5.92e2	SMART
low complexity region	3178	3187	N/A	INTRINSIC
PbH1	3188	3212	8.08e3	SMART
transmembrane domain	3852	3874	N/A	INTRINSIC

Meta Mutation Damage Score

0.3026

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to have a single transmembrane (TM)-spanning domain and multiple copies of an immunoglobulin-like plexin-transcription-factor domain. Alternative splicing results in two transcript variants encoding different isoforms. Other alternatively spliced transcripts have been described, but the full length sequences have not been determined. Several of these transcripts are predicted to encode truncated products which lack the TM and may be secreted. Mutations in this gene cause autosomal recessive polycystic kidney disease, also known as polycystic kidney and hepatic disease-1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a mutation in this gene display variable progressive liver cysts and fibrosis, but do not display kidney cysts and are fertile. Mice homozygous for a hypomorphic and null allele display renal, pancreatic, billiary and liver cysts. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Targeted, knock-out(2) Targeted, other(4)

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	T	A	6: 121,636,282 (GRCm39)	M717K	probably benign	Het
Acad12	C	A	5: 121,748,029 (GRCm39)	V130L	probably benign	Het
Cdca2	T	C	14: 67,937,471 (GRCm39)		probably benign	Het
Cfap100	T	A	6: 90,389,332 (GRCm39)		probably null	Het
Cfap43	T	A	19: 47,804,302 (GRCm39)	E298V	probably damaging	Het
Cic	C	T	7: 24,990,500 (GRCm39)	P1971S	probably damaging	Het
Cnga1	T	C	5: 72,761,681 (GRCm39)	D611G	probably benign	Het
Daglb	C	T	5: 143,486,948 (GRCm39)	P522L	probably damaging	Het
Dclre1b	A	T	3: 103,710,597 (GRCm39)	I438K	probably benign	Het
Ddx5	C	A	11: 106,675,871 (GRCm39)	R273M	probably damaging	Het
Eepd1	C	T	9: 25,393,981 (GRCm39)	L82F	probably damaging	Het
Emilin3	G	A	2: 160,750,649 (GRCm39)	Q320*	probably null	Het
Exoc6	T	C	19: 37,582,217 (GRCm39)		probably null	Het
Fcna	G	C	2: 25,520,693 (GRCm39)		probably benign	Het
Foxs1	T	C	2: 152,774,484 (GRCm39)	T190A	probably benign	Het
Gje1	A	G	10: 14,592,374 (GRCm39)	L136P	probably damaging	Het
Hdac11	A	G	6: 91,145,827 (GRCm39)	T176A	probably benign	Het
Hhip	C	A	8: 80,698,967 (GRCm39)	V700L	probably damaging	Het
Hps5	T	C	7: 46,426,463 (GRCm39)		probably benign	Het
Itgb1bp1	T	C	12: 21,329,436 (GRCm39)	S13G	unknown	Het
Kcna1	A	T	6: 126,619,148 (GRCm39)	L391M	possibly damaging	Het
Kif1a	C	T	1: 93,010,128 (GRCm39)	V6M	probably damaging	Het
Klhl6	T	C	16: 19,801,639 (GRCm39)	I39V	probably benign	Het
Lpcat4	C	A	2: 112,072,334 (GRCm39)		silent	Het
Ltn1	A	T	16: 87,202,509 (GRCm39)	S1047R	probably benign	Het
Mdn1	A	G	4: 32,694,495 (GRCm39)	T1073A	possibly damaging	Het
Megf10	G	T	18: 57,421,055 (GRCm39)	A898S	possibly damaging	Het
Mtmr6	T	C	14: 60,529,577 (GRCm39)		probably null	Het
Mtnr1b	T	C	9: 15,774,059 (GRCm39)	I333M	probably benign	Het
Muc5ac	G	T	7: 141,348,950 (GRCm39)	C463F	probably benign	Het
Mycbpap	G	T	11: 94,396,543 (GRCm39)	T99N	possibly damaging	Het
Myo7a	C	T	7: 97,728,534 (GRCm39)	C824Y	probably damaging	Het
N4bp2	A	G	5: 65,948,303 (GRCm39)	H311R	probably damaging	Het
Nepro	T	A	16: 44,552,509 (GRCm39)		probably benign	Het
Nop56	A	T	2: 130,117,489 (GRCm39)		probably benign	Het
Nup210	A	G	6: 90,995,978 (GRCm39)		probably benign	Het
Or4d10c	A	G	19: 12,065,391 (GRCm39)	V255A	probably damaging	Het
Or7g25	T	A	9: 19,160,441 (GRCm39)	I85F	probably damaging	Het
Pcna	C	T	2: 132,093,673 (GRCm39)	E109K	probably benign	Het
Pgap6	A	T	17: 26,338,414 (GRCm39)		probably null	Het
Plb1	A	G	5: 32,485,756 (GRCm39)	R847G	probably damaging	Het
Pou6f2	A	G	13: 18,303,612 (GRCm39)		probably benign	Het
Prss43	C	G	9: 110,660,049 (GRCm39)	S371C	probably benign	Het
Ralgapa1	A	T	12: 55,741,942 (GRCm39)	V1322D	probably damaging	Het
Rrp8	A	G	7: 105,384,109 (GRCm39)	V131A	probably benign	Het
Rtp1	A	T	16: 23,248,044 (GRCm39)	K39M	probably benign	Het
Sanbr	A	T	11: 23,565,150 (GRCm39)	L279Q	possibly damaging	Het
Slc1a6	A	G	10: 78,636,008 (GRCm39)	I358V	probably benign	Het
Slc25a15	T	C	8: 22,885,726 (GRCm39)		probably benign	Het
Slc43a1	G	A	2: 84,684,897 (GRCm39)		probably benign	Het
Speer4c1	A	C	5: 15,919,214 (GRCm39)		probably benign	Het
Spock3	T	G	8: 63,802,018 (GRCm39)		probably null	Het
Tbc1d7	T	C	13: 43,308,162 (GRCm39)		probably null	Het
Tmem184c	C	T	8: 78,326,286 (GRCm39)	W260*	probably null	Het
Trnau1ap	A	G	4: 132,039,252 (GRCm39)	Y265H	probably damaging	Het
Usp25	T	C	16: 76,871,754 (GRCm39)	F363S	probably damaging	Het
Vcl	T	C	14: 21,072,085 (GRCm39)	F817L	possibly damaging	Het
Vmn1r13	T	A	6: 57,187,717 (GRCm39)	M292K	probably benign	Het
Xpc	G	T	6: 91,487,463 (GRCm39)	A89E	probably damaging	Het

Other mutations in Pkhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Pkhd1	APN	1	20,637,098 (GRCm39)	critical splice acceptor site	probably null
IGL00687:Pkhd1	APN	1	20,594,294 (GRCm39)	missense	probably benign	0.19
IGL00824:Pkhd1	APN	1	20,151,408 (GRCm39)	critical splice donor site	probably null
IGL00870:Pkhd1	APN	1	20,641,614 (GRCm39)	missense	probably damaging	1.00
IGL00911:Pkhd1	APN	1	20,187,971 (GRCm39)	missense	probably benign	0.00
IGL01015:Pkhd1	APN	1	20,593,482 (GRCm39)	missense	possibly damaging	0.95
IGL01025:Pkhd1	APN	1	20,279,400 (GRCm39)	missense	probably benign	0.04
IGL01064:Pkhd1	APN	1	20,604,754 (GRCm39)	splice site	probably benign
IGL01313:Pkhd1	APN	1	20,271,248 (GRCm39)	missense	probably damaging	1.00
IGL01340:Pkhd1	APN	1	20,593,201 (GRCm39)	missense	probably benign	0.01
IGL01352:Pkhd1	APN	1	20,619,939 (GRCm39)	missense	probably benign	0.34
IGL01456:Pkhd1	APN	1	20,269,683 (GRCm39)	missense	probably damaging	1.00
IGL01530:Pkhd1	APN	1	20,629,643 (GRCm39)	critical splice donor site	probably null
IGL01557:Pkhd1	APN	1	20,187,203 (GRCm39)	missense	possibly damaging	0.59
IGL01655:Pkhd1	APN	1	20,604,857 (GRCm39)	nonsense	probably null
IGL01790:Pkhd1	APN	1	20,628,895 (GRCm39)	missense	probably damaging	0.96
IGL01862:Pkhd1	APN	1	20,429,134 (GRCm39)	missense	probably damaging	1.00
IGL01874:Pkhd1	APN	1	20,173,459 (GRCm39)	missense	probably benign	0.32
IGL01901:Pkhd1	APN	1	20,290,307 (GRCm39)	missense	probably benign	0.11
IGL01903:Pkhd1	APN	1	20,268,361 (GRCm39)	missense	probably damaging	1.00
IGL01981:Pkhd1	APN	1	20,593,791 (GRCm39)	missense	possibly damaging	0.64
IGL02068:Pkhd1	APN	1	20,592,971 (GRCm39)	missense	probably damaging	1.00
IGL02083:Pkhd1	APN	1	20,271,451 (GRCm39)	missense	probably damaging	1.00
IGL02084:Pkhd1	APN	1	20,447,623 (GRCm39)	missense	probably damaging	1.00
IGL02126:Pkhd1	APN	1	20,187,419 (GRCm39)	missense	probably damaging	1.00
IGL02136:Pkhd1	APN	1	20,345,839 (GRCm39)	missense	probably damaging	1.00
IGL02255:Pkhd1	APN	1	20,654,325 (GRCm39)	missense	probably damaging	1.00
IGL02272:Pkhd1	APN	1	20,279,484 (GRCm39)	missense	probably damaging	1.00
IGL02308:Pkhd1	APN	1	20,140,600 (GRCm39)	critical splice donor site	probably null
IGL02364:Pkhd1	APN	1	20,271,007 (GRCm39)	missense	probably benign
IGL02389:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02394:Pkhd1	APN	1	20,269,710 (GRCm39)	missense	possibly damaging	0.57
IGL02403:Pkhd1	APN	1	20,632,642 (GRCm39)	missense	probably benign	0.01
IGL02415:Pkhd1	APN	1	20,484,645 (GRCm39)	missense	probably damaging	1.00
IGL02415:Pkhd1	APN	1	20,592,983 (GRCm39)	missense	probably damaging	1.00
IGL02455:Pkhd1	APN	1	20,434,425 (GRCm39)	missense	probably damaging	1.00
IGL02502:Pkhd1	APN	1	20,462,389 (GRCm39)	missense	probably damaging	1.00
IGL02511:Pkhd1	APN	1	20,143,731 (GRCm39)	missense	possibly damaging	0.90
IGL02530:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02532:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02534:Pkhd1	APN	1	20,187,944 (GRCm39)	missense	probably damaging	0.99
IGL02556:Pkhd1	APN	1	20,380,934 (GRCm39)	missense	probably damaging	1.00
IGL02570:Pkhd1	APN	1	20,590,480 (GRCm39)	missense	probably damaging	0.99
IGL02605:Pkhd1	APN	1	20,621,126 (GRCm39)	missense	possibly damaging	0.66
IGL02641:Pkhd1	APN	1	20,628,976 (GRCm39)	missense	possibly damaging	0.61
IGL02741:Pkhd1	APN	1	20,290,253 (GRCm39)	splice site	probably benign
IGL02752:Pkhd1	APN	1	20,623,815 (GRCm39)	missense	possibly damaging	0.57
IGL02890:Pkhd1	APN	1	20,431,235 (GRCm39)	missense	probably damaging	1.00
IGL02959:Pkhd1	APN	1	20,678,640 (GRCm39)	nonsense	probably null
IGL02960:Pkhd1	APN	1	20,447,670 (GRCm39)	missense	possibly damaging	0.69
IGL02990:Pkhd1	APN	1	20,593,187 (GRCm39)	missense	possibly damaging	0.52
IGL03037:Pkhd1	APN	1	20,592,923 (GRCm39)	missense	probably benign	0.06
IGL03082:Pkhd1	APN	1	20,635,857 (GRCm39)	missense	probably damaging	1.00
IGL03114:Pkhd1	APN	1	20,268,395 (GRCm39)	missense	probably damaging	0.99
IGL03288:Pkhd1	APN	1	20,271,243 (GRCm39)	missense	probably benign	0.01
IGL03328:Pkhd1	APN	1	20,151,524 (GRCm39)	splice site	probably benign
IGL03375:Pkhd1	APN	1	20,187,247 (GRCm39)	missense	probably damaging	1.00
IGL03380:Pkhd1	APN	1	20,270,894 (GRCm39)	missense	probably damaging	1.00
0152:Pkhd1	UTSW	1	20,593,118 (GRCm39)	missense	possibly damaging	0.46
LCD18:Pkhd1	UTSW	1	20,681,638 (GRCm39)	intron	probably benign
P0035:Pkhd1	UTSW	1	20,187,571 (GRCm39)	missense	probably benign	0.00
PIT4260001:Pkhd1	UTSW	1	20,293,130 (GRCm39)	missense	possibly damaging	0.51
R0063:Pkhd1	UTSW	1	20,282,174 (GRCm39)	missense	probably benign	0.02
R0063:Pkhd1	UTSW	1	20,282,174 (GRCm39)	missense	probably benign	0.02
R0071:Pkhd1	UTSW	1	20,271,568 (GRCm39)	missense	probably benign	0.11
R0071:Pkhd1	UTSW	1	20,271,568 (GRCm39)	missense	probably benign	0.11
R0094:Pkhd1	UTSW	1	20,279,470 (GRCm39)	missense	probably damaging	1.00
R0094:Pkhd1	UTSW	1	20,279,470 (GRCm39)	missense	probably damaging	1.00
R0103:Pkhd1	UTSW	1	20,593,583 (GRCm39)	missense	probably benign	0.04
R0103:Pkhd1	UTSW	1	20,593,583 (GRCm39)	missense	probably benign	0.04
R0105:Pkhd1	UTSW	1	20,593,956 (GRCm39)	nonsense	probably null
R0105:Pkhd1	UTSW	1	20,593,956 (GRCm39)	nonsense	probably null
R0115:Pkhd1	UTSW	1	20,420,714 (GRCm39)	missense	probably damaging	1.00
R0193:Pkhd1	UTSW	1	20,429,141 (GRCm39)	missense	probably damaging	1.00
R0245:Pkhd1	UTSW	1	20,610,624 (GRCm39)	missense	probably benign	0.03
R0277:Pkhd1	UTSW	1	20,345,762 (GRCm39)	missense	probably benign	0.04
R0310:Pkhd1	UTSW	1	20,620,046 (GRCm39)	splice site	probably null
R0323:Pkhd1	UTSW	1	20,345,762 (GRCm39)	missense	probably benign	0.04
R0395:Pkhd1	UTSW	1	20,451,771 (GRCm39)	missense	probably benign	0.26
R0412:Pkhd1	UTSW	1	20,188,012 (GRCm39)	missense	probably damaging	1.00
R0506:Pkhd1	UTSW	1	20,629,693 (GRCm39)	missense	probably benign	0.00
R0512:Pkhd1	UTSW	1	20,380,738 (GRCm39)	splice site	probably benign
R0550:Pkhd1	UTSW	1	20,417,447 (GRCm39)	missense	probably null	1.00
R0584:Pkhd1	UTSW	1	20,309,660 (GRCm39)	nonsense	probably null
R0586:Pkhd1	UTSW	1	20,594,335 (GRCm39)	missense	probably benign	0.04
R0598:Pkhd1	UTSW	1	20,271,114 (GRCm39)	missense	probably damaging	1.00
R0603:Pkhd1	UTSW	1	20,187,397 (GRCm39)	missense	probably benign	0.05
R0634:Pkhd1	UTSW	1	20,187,698 (GRCm39)	missense	probably damaging	1.00
R0677:Pkhd1	UTSW	1	20,594,454 (GRCm39)	missense	probably benign	0.01
R0746:Pkhd1	UTSW	1	20,268,331 (GRCm39)	missense	probably damaging	1.00
R0781:Pkhd1	UTSW	1	20,187,708 (GRCm39)	missense	probably benign	0.01
R0840:Pkhd1	UTSW	1	20,420,745 (GRCm39)	missense	probably damaging	0.98
R0946:Pkhd1	UTSW	1	20,269,605 (GRCm39)	missense	probably benign	0.10
R1018:Pkhd1	UTSW	1	20,271,483 (GRCm39)	missense	possibly damaging	0.89
R1028:Pkhd1	UTSW	1	20,187,950 (GRCm39)	missense	probably damaging	1.00
R1136:Pkhd1	UTSW	1	20,593,053 (GRCm39)	missense	possibly damaging	0.68
R1178:Pkhd1	UTSW	1	20,655,381 (GRCm39)	critical splice donor site	probably null
R1180:Pkhd1	UTSW	1	20,655,381 (GRCm39)	critical splice donor site	probably null
R1222:Pkhd1	UTSW	1	20,637,680 (GRCm39)	missense	probably benign	0.07
R1334:Pkhd1	UTSW	1	20,604,129 (GRCm39)	missense	possibly damaging	0.81
R1335:Pkhd1	UTSW	1	20,641,629 (GRCm39)	missense	probably damaging	1.00
R1387:Pkhd1	UTSW	1	20,625,447 (GRCm39)	splice site	probably benign
R1411:Pkhd1	UTSW	1	20,444,120 (GRCm39)	missense	probably damaging	1.00
R1443:Pkhd1	UTSW	1	20,604,782 (GRCm39)	missense	probably damaging	1.00
R1448:Pkhd1	UTSW	1	20,655,381 (GRCm39)	critical splice donor site	probably null
R1468:Pkhd1	UTSW	1	20,593,565 (GRCm39)	missense	probably damaging	1.00
R1468:Pkhd1	UTSW	1	20,593,565 (GRCm39)	missense	probably damaging	1.00
R1473:Pkhd1	UTSW	1	20,593,207 (GRCm39)	missense	probably benign	0.00
R1524:Pkhd1	UTSW	1	20,188,004 (GRCm39)	missense	probably damaging	1.00
R1532:Pkhd1	UTSW	1	20,187,625 (GRCm39)	missense	probably benign	0.08
R1565:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1572:Pkhd1	UTSW	1	20,417,664 (GRCm39)	missense	probably benign	0.02
R1583:Pkhd1	UTSW	1	20,188,049 (GRCm39)	missense	probably benign
R1617:Pkhd1	UTSW	1	20,268,274 (GRCm39)	missense	possibly damaging	0.95
R1631:Pkhd1	UTSW	1	20,593,121 (GRCm39)	missense	probably benign	0.06
R1655:Pkhd1	UTSW	1	20,654,353 (GRCm39)	missense	probably damaging	1.00
R1707:Pkhd1	UTSW	1	20,621,064 (GRCm39)	splice site	probably benign
R1753:Pkhd1	UTSW	1	20,604,129 (GRCm39)	missense	possibly damaging	0.81
R1782:Pkhd1	UTSW	1	20,635,935 (GRCm39)	missense	probably damaging	0.98
R1791:Pkhd1	UTSW	1	20,655,376 (GRCm39)	splice site	probably benign
R1822:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1823:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1824:Pkhd1	UTSW	1	20,417,681 (GRCm39)	missense	probably damaging	1.00
R1836:Pkhd1	UTSW	1	20,187,293 (GRCm39)	missense	probably benign	0.01
R1862:Pkhd1	UTSW	1	20,621,244 (GRCm39)	missense	probably benign	0.00
R1863:Pkhd1	UTSW	1	20,621,244 (GRCm39)	missense	probably benign	0.00
R1869:Pkhd1	UTSW	1	20,685,491 (GRCm39)	critical splice donor site	probably null
R1913:Pkhd1	UTSW	1	20,636,980 (GRCm39)	critical splice donor site	probably null
R1928:Pkhd1	UTSW	1	20,151,524 (GRCm39)	splice site	probably benign
R1969:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R1970:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R1981:Pkhd1	UTSW	1	20,187,284 (GRCm39)	missense	probably benign	0.00
R2008:Pkhd1	UTSW	1	20,269,683 (GRCm39)	missense	probably damaging	0.99
R2034:Pkhd1	UTSW	1	20,270,893 (GRCm39)	missense	probably damaging	1.00
R2061:Pkhd1	UTSW	1	20,683,036 (GRCm39)	missense	possibly damaging	0.76
R2062:Pkhd1	UTSW	1	20,271,559 (GRCm39)	missense	probably damaging	0.97
R2108:Pkhd1	UTSW	1	20,623,798 (GRCm39)	nonsense	probably null
R2142:Pkhd1	UTSW	1	20,594,119 (GRCm39)	missense	probably benign	0.00
R2148:Pkhd1	UTSW	1	20,484,444 (GRCm39)	critical splice donor site	probably null
R2176:Pkhd1	UTSW	1	20,623,741 (GRCm39)	missense	probably damaging	1.00
R2202:Pkhd1	UTSW	1	20,607,584 (GRCm39)	missense	probably benign	0.06
R2255:Pkhd1	UTSW	1	20,635,863 (GRCm39)	missense	probably benign	0.23
R2269:Pkhd1	UTSW	1	20,604,759 (GRCm39)	critical splice donor site	probably null
R2275:Pkhd1	UTSW	1	20,271,073 (GRCm39)	missense	possibly damaging	0.95
R2340:Pkhd1	UTSW	1	20,271,079 (GRCm39)	missense	probably damaging	1.00
R2431:Pkhd1	UTSW	1	20,271,389 (GRCm39)	missense	possibly damaging	0.63
R2679:Pkhd1	UTSW	1	20,279,406 (GRCm39)	missense	probably benign	0.03
R2850:Pkhd1	UTSW	1	20,579,300 (GRCm39)	missense	possibly damaging	0.89
R2851:Pkhd1	UTSW	1	20,128,526 (GRCm39)	missense	probably benign	0.16
R2853:Pkhd1	UTSW	1	20,128,526 (GRCm39)	missense	probably benign	0.16
R2984:Pkhd1	UTSW	1	20,293,185 (GRCm39)	missense	possibly damaging	0.84
R2987:Pkhd1	UTSW	1	20,174,823 (GRCm39)	missense	possibly damaging	0.87
R3692:Pkhd1	UTSW	1	20,625,353 (GRCm39)	missense	possibly damaging	0.87
R3721:Pkhd1	UTSW	1	20,655,879 (GRCm39)	missense	probably benign	0.08
R3746:Pkhd1	UTSW	1	20,128,524 (GRCm39)	makesense	probably null
R3838:Pkhd1	UTSW	1	20,604,853 (GRCm39)	missense	possibly damaging	0.66
R3843:Pkhd1	UTSW	1	20,628,947 (GRCm39)	missense	probably benign	0.00
R3861:Pkhd1	UTSW	1	20,271,151 (GRCm39)	missense	probably damaging	1.00
R3893:Pkhd1	UTSW	1	20,382,362 (GRCm39)	nonsense	probably null
R3926:Pkhd1	UTSW	1	20,621,097 (GRCm39)	missense	probably benign	0.00
R4183:Pkhd1	UTSW	1	20,188,031 (GRCm39)	missense	probably benign	0.03
R4184:Pkhd1	UTSW	1	20,633,910 (GRCm39)	missense	probably benign	0.06
R4184:Pkhd1	UTSW	1	20,279,501 (GRCm39)	missense	probably benign	0.03
R4255:Pkhd1	UTSW	1	20,664,158 (GRCm39)	missense	probably damaging	0.99
R4275:Pkhd1	UTSW	1	20,128,608 (GRCm39)	missense	probably benign	0.00
R4342:Pkhd1	UTSW	1	20,128,841 (GRCm39)	missense	probably benign	0.00
R4386:Pkhd1	UTSW	1	20,484,516 (GRCm39)	missense	probably benign	0.00
R4402:Pkhd1	UTSW	1	20,309,635 (GRCm39)	missense	probably damaging	1.00
R4431:Pkhd1	UTSW	1	20,593,538 (GRCm39)	missense	probably damaging	0.99
R4560:Pkhd1	UTSW	1	20,282,082 (GRCm39)	missense	probably damaging	1.00
R4561:Pkhd1	UTSW	1	20,604,943 (GRCm39)	missense	possibly damaging	0.89
R4570:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R4571:Pkhd1	UTSW	1	20,683,633 (GRCm39)	missense	probably damaging	1.00
R4588:Pkhd1	UTSW	1	20,271,092 (GRCm39)	missense	probably benign	0.00
R4598:Pkhd1	UTSW	1	20,573,280 (GRCm39)	missense	probably damaging	1.00
R4651:Pkhd1	UTSW	1	20,451,747 (GRCm39)	missense	probably damaging	1.00
R4657:Pkhd1	UTSW	1	20,434,391 (GRCm39)	missense	possibly damaging	0.89
R4718:Pkhd1	UTSW	1	20,151,452 (GRCm39)	missense	probably damaging	1.00
R4740:Pkhd1	UTSW	1	20,594,354 (GRCm39)	missense	probably benign
R4750:Pkhd1	UTSW	1	20,594,336 (GRCm39)	missense	possibly damaging	0.57
R4816:Pkhd1	UTSW	1	20,269,639 (GRCm39)	missense	probably damaging	0.99
R4825:Pkhd1	UTSW	1	20,607,625 (GRCm39)	missense	probably damaging	0.96
R4885:Pkhd1	UTSW	1	20,140,712 (GRCm39)	missense	possibly damaging	0.55
R4907:Pkhd1	UTSW	1	20,279,450 (GRCm39)	missense	probably damaging	1.00
R4944:Pkhd1	UTSW	1	20,358,429 (GRCm39)	missense	probably null	0.01
R5062:Pkhd1	UTSW	1	20,655,935 (GRCm39)	missense	probably benign	0.00
R5090:Pkhd1	UTSW	1	20,270,981 (GRCm39)	missense	probably damaging	1.00
R5104:Pkhd1	UTSW	1	20,655,415 (GRCm39)	missense	probably damaging	1.00
R5187:Pkhd1	UTSW	1	20,279,448 (GRCm39)	missense	possibly damaging	0.67
R5202:Pkhd1	UTSW	1	20,617,565 (GRCm39)	missense	probably benign	0.01
R5240:Pkhd1	UTSW	1	20,345,865 (GRCm39)	missense	probably benign	0.04
R5248:Pkhd1	UTSW	1	20,604,769 (GRCm39)	missense	probably benign	0.00
R5252:Pkhd1	UTSW	1	20,420,635 (GRCm39)	critical splice donor site	probably null
R5293:Pkhd1	UTSW	1	20,579,300 (GRCm39)	missense	possibly damaging	0.89
R5311:Pkhd1	UTSW	1	20,636,094 (GRCm39)	missense	possibly damaging	0.94
R5317:Pkhd1	UTSW	1	20,520,528 (GRCm39)	missense	probably damaging	1.00
R5346:Pkhd1	UTSW	1	20,593,658 (GRCm39)	missense	probably damaging	0.96
R5346:Pkhd1	UTSW	1	20,462,321 (GRCm39)	missense	probably benign
R5431:Pkhd1	UTSW	1	20,188,060 (GRCm39)	missense	probably benign	0.25
R5447:Pkhd1	UTSW	1	20,309,609 (GRCm39)	missense	probably benign	0.00
R5478:Pkhd1	UTSW	1	20,271,380 (GRCm39)	missense	probably damaging	1.00
R5497:Pkhd1	UTSW	1	20,447,628 (GRCm39)	missense	possibly damaging	0.94
R5554:Pkhd1	UTSW	1	20,151,476 (GRCm39)	missense	probably damaging	0.99
R5579:Pkhd1	UTSW	1	20,593,366 (GRCm39)	missense	probably damaging	0.96
R5614:Pkhd1	UTSW	1	20,143,750 (GRCm39)	missense	possibly damaging	0.83
R5648:Pkhd1	UTSW	1	20,628,850 (GRCm39)	missense	probably benign	0.04
R5651:Pkhd1	UTSW	1	20,188,031 (GRCm39)	missense	probably benign	0.03
R5665:Pkhd1	UTSW	1	20,658,755 (GRCm39)	missense	probably damaging	1.00
R5681:Pkhd1	UTSW	1	20,617,685 (GRCm39)	missense	possibly damaging	0.61
R5754:Pkhd1	UTSW	1	20,593,875 (GRCm39)	nonsense	probably null
R5760:Pkhd1	UTSW	1	20,143,778 (GRCm39)	missense	probably benign	0.02
R5776:Pkhd1	UTSW	1	20,279,409 (GRCm39)	missense	possibly damaging	0.62
R5782:Pkhd1	UTSW	1	20,128,824 (GRCm39)	missense	probably benign
R5810:Pkhd1	UTSW	1	20,270,897 (GRCm39)	missense	probably benign	0.26
R5814:Pkhd1	UTSW	1	20,269,629 (GRCm39)	missense	probably damaging	1.00
R5816:Pkhd1	UTSW	1	20,128,902 (GRCm39)	missense	probably benign	0.03
R5835:Pkhd1	UTSW	1	20,271,307 (GRCm39)	missense	probably benign	0.01
R5844:Pkhd1	UTSW	1	20,451,685 (GRCm39)	missense	probably benign	0.00
R5847:Pkhd1	UTSW	1	20,444,960 (GRCm39)	nonsense	probably null
R5852:Pkhd1	UTSW	1	20,447,632 (GRCm39)	missense	probably benign	0.22
R5863:Pkhd1	UTSW	1	20,590,434 (GRCm39)	missense	possibly damaging	0.63
R6213:Pkhd1	UTSW	1	20,593,994 (GRCm39)	missense	possibly damaging	0.80
R6351:Pkhd1	UTSW	1	20,282,175 (GRCm39)	missense	probably benign	0.00
R6386:Pkhd1	UTSW	1	20,621,244 (GRCm39)	missense	probably damaging	0.96
R6542:Pkhd1	UTSW	1	20,655,927 (GRCm39)	missense	probably benign	0.02
R6579:Pkhd1	UTSW	1	20,271,047 (GRCm39)	missense	probably benign	0.01
R6658:Pkhd1	UTSW	1	20,682,929 (GRCm39)	missense	probably damaging	1.00
R6765:Pkhd1	UTSW	1	20,128,563 (GRCm39)	missense	probably benign
R6886:Pkhd1	UTSW	1	20,417,504 (GRCm39)	missense	probably benign	0.01
R6892:Pkhd1	UTSW	1	20,593,739 (GRCm39)	missense	probably damaging	1.00
R6900:Pkhd1	UTSW	1	20,604,925 (GRCm39)	missense	probably benign	0.06
R6932:Pkhd1	UTSW	1	20,632,675 (GRCm39)	missense	probably benign	0.19
R7191:Pkhd1	UTSW	1	20,628,943 (GRCm39)	missense	probably benign	0.00
R7220:Pkhd1	UTSW	1	20,593,350 (GRCm39)	missense	possibly damaging	0.89
R7329:Pkhd1	UTSW	1	20,617,743 (GRCm39)	missense	probably damaging	0.96
R7361:Pkhd1	UTSW	1	20,664,177 (GRCm39)	missense	probably damaging	1.00
R7381:Pkhd1	UTSW	1	20,271,197 (GRCm39)	missense	probably damaging	1.00
R7388:Pkhd1	UTSW	1	20,309,528 (GRCm39)	missense	not run
R7436:Pkhd1	UTSW	1	20,270,925 (GRCm39)	missense	probably benign
R7473:Pkhd1	UTSW	1	20,619,980 (GRCm39)	missense	probably damaging	0.99
R7578:Pkhd1	UTSW	1	20,417,585 (GRCm39)	missense	probably damaging	1.00
R7751:Pkhd1	UTSW	1	20,271,149 (GRCm39)	missense	probably damaging	1.00
R7755:Pkhd1	UTSW	1	20,617,717 (GRCm39)	missense	probably damaging	0.98
R7757:Pkhd1	UTSW	1	20,632,639 (GRCm39)	missense	probably damaging	1.00
R7832:Pkhd1	UTSW	1	20,573,223 (GRCm39)	missense	probably damaging	1.00
R7834:Pkhd1	UTSW	1	20,382,273 (GRCm39)	missense	probably benign
R7920:Pkhd1	UTSW	1	20,345,759 (GRCm39)	missense	probably damaging	1.00
R8014:Pkhd1	UTSW	1	20,579,115 (GRCm39)	critical splice donor site	probably null
R8034:Pkhd1	UTSW	1	20,451,662 (GRCm39)	missense	possibly damaging	0.94
R8085:Pkhd1	UTSW	1	20,683,639 (GRCm39)	missense	probably damaging	1.00
R8087:Pkhd1	UTSW	1	20,593,313 (GRCm39)	missense	probably damaging	1.00
R8103:Pkhd1	UTSW	1	20,270,981 (GRCm39)	missense	probably damaging	1.00
R8122:Pkhd1	UTSW	1	20,632,682 (GRCm39)	missense	probably damaging	1.00
R8273:Pkhd1	UTSW	1	20,607,644 (GRCm39)	splice site	probably benign
R8485:Pkhd1	UTSW	1	20,593,257 (GRCm39)	missense	probably damaging	1.00
R8504:Pkhd1	UTSW	1	20,590,432 (GRCm39)	missense	probably benign	0.10
R8544:Pkhd1	UTSW	1	20,593,199 (GRCm39)	missense	probably damaging	1.00
R8692:Pkhd1	UTSW	1	20,462,374 (GRCm39)	missense	probably damaging	1.00
R8787:Pkhd1	UTSW	1	20,358,461 (GRCm39)	missense	probably damaging	0.99
R8853:Pkhd1	UTSW	1	20,143,679 (GRCm39)	critical splice donor site	probably null
R8907:Pkhd1	UTSW	1	20,187,785 (GRCm39)	missense	possibly damaging	0.88
R8934:Pkhd1	UTSW	1	20,462,234 (GRCm39)	critical splice donor site	probably null
R8990:Pkhd1	UTSW	1	20,417,529 (GRCm39)	missense	probably benign	0.00
R8998:Pkhd1	UTSW	1	20,434,425 (GRCm39)	missense	probably damaging	1.00
R9024:Pkhd1	UTSW	1	20,592,975 (GRCm39)	missense	probably benign	0.24
R9035:Pkhd1	UTSW	1	20,573,176 (GRCm39)	missense	probably damaging	1.00
R9092:Pkhd1	UTSW	1	20,632,586 (GRCm39)	missense	probably benign	0.00
R9238:Pkhd1	UTSW	1	20,604,799 (GRCm39)	missense	possibly damaging	0.89
R9258:Pkhd1	UTSW	1	20,444,174 (GRCm39)	missense	probably damaging	0.99
R9262:Pkhd1	UTSW	1	20,618,351 (GRCm39)	missense	probably benign	0.01
R9297:Pkhd1	UTSW	1	20,293,118 (GRCm39)	missense	probably benign	0.06
R9452:Pkhd1	UTSW	1	20,682,953 (GRCm39)	missense	possibly damaging	0.77
R9515:Pkhd1	UTSW	1	20,637,741 (GRCm39)	missense	probably damaging	1.00
R9540:Pkhd1	UTSW	1	20,269,570 (GRCm39)	missense	probably benign	0.00
R9542:Pkhd1	UTSW	1	20,188,004 (GRCm39)	missense	probably damaging	1.00
R9629:Pkhd1	UTSW	1	20,462,437 (GRCm39)	missense	possibly damaging	0.63
R9644:Pkhd1	UTSW	1	20,617,690 (GRCm39)	missense	probably benign	0.04
R9739:Pkhd1	UTSW	1	20,420,708 (GRCm39)	missense	probably damaging	1.00
R9767:Pkhd1	UTSW	1	20,484,636 (GRCm39)	missense	probably benign
R9781:Pkhd1	UTSW	1	20,187,665 (GRCm39)	missense	possibly damaging	0.95
R9803:Pkhd1	UTSW	1	20,637,073 (GRCm39)	missense	probably damaging	1.00
X0012:Pkhd1	UTSW	1	20,444,150 (GRCm39)	missense	probably damaging	1.00
X0067:Pkhd1	UTSW	1	20,590,450 (GRCm39)	missense	probably damaging	1.00
Z1176:Pkhd1	UTSW	1	20,593,971 (GRCm39)	missense	possibly damaging	0.81
Z1177:Pkhd1	UTSW	1	20,593,845 (GRCm39)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,380,818 (GRCm39)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,188,107 (GRCm39)	missense	probably damaging	1.00
Z1177:Pkhd1	UTSW	1	20,621,243 (GRCm39)	missense	probably benign
Z1177:Pkhd1	UTSW	1	20,594,162 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAAGTCCCATTTTCACAGAG -3'
(R):5'- AAATTCTTGCCTCCCTGCAGG -3'

Sequencing Primer
(F):5'- TGGACTAAACAGTGAGTCCCTGTC -3'
(R):5'- TCCCTGCAGGAGCTGAGAAAATG -3'

Posted On

2016-06-07