Mutagenetix > Incidental Mutation

Incidental Mutation 'S24628:Pax5'

385649

Institutional Source

Beutler Lab

Gene Symbol

Pax5

Ensembl Gene

ENSMUSG00000014030

Gene Name

paired box 5

Synonyms

EBB-1, Pax-5

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

S24628 () of strain waterfowl

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44524757-44710487 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 44691886 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Valine at position 120 (A120V)

Ref Sequence

ENSEMBL: ENSMUSP00000103457 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014174] [ENSMUST00000102932] [ENSMUST00000107825] [ENSMUST00000107826] [ENSMUST00000107827] [ENSMUST00000134968] [ENSMUST00000143235] [ENSMUST00000173821] [ENSMUST00000146335] [ENSMUST00000174242] [ENSMUST00000165417] [ENSMUST00000173733] [ENSMUST00000186542]

AlphaFold

Q02650

Predicted Effect

probably benign
Transcript: ENSMUST00000014174
AA Change: A120V

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000014174
Gene: ENSMUSG00000014030
AA Change: A120V

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	1e-4	SMART
Pfam:Pax2_C	279	390	6e-53	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102932
AA Change: A120V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000099996
Gene: ENSMUSG00000014030
AA Change: A120V

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	1e-4	SMART
Pfam:Pax2_C	276	341	1.1e-25	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107825
AA Change: A120V

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103455
Gene: ENSMUSG00000014030
AA Change: A120V

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	2e-4	SMART
Pfam:Pax2_C	279	356	5.7e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107826
AA Change: A120V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000103457
Gene: ENSMUSG00000014030
AA Change: A120V

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	7e-4	SMART
low complexity region	269	281	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000107827
AA Change: A120V

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000103458
Gene: ENSMUSG00000014030
AA Change: A120V

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	4e-4	SMART
low complexity region	298	310	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000134968
AA Change: A120V

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000133540
Gene: ENSMUSG00000014030
AA Change: A120V

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
SCOP:d1ftt__	177	211	1e-4	SMART
Pfam:Pax2_C	233	298	2.4e-25	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000143235
AA Change: A120V

PolyPhen 2 Score 0.789 (Sensitivity: 0.85; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134370
Gene: ENSMUSG00000014030
AA Change: A120V

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	1e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187197

Predicted Effect

possibly damaging
Transcript: ENSMUST00000173821
AA Change: A120V

PolyPhen 2 Score 0.560 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000134712
Gene: ENSMUSG00000014030
AA Change: A120V

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	2e-4	SMART
low complexity region	306	325	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000146335
AA Change: A119V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000139296
Gene: ENSMUSG00000014030
AA Change: A119V

Domain	Start	End	E-Value	Type
PAX	15	139	8e-96	SMART
low complexity region	156	188	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000174242
AA Change: A120V

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000134391
Gene: ENSMUSG00000014030
AA Change: A120V

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
low complexity region	157	189	N/A	INTRINSIC
SCOP:d1ftt__	220	254	2e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174761

Predicted Effect

probably benign
Transcript: ENSMUST00000165417
AA Change: A120V

PolyPhen 2 Score 0.072 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000128880
Gene: ENSMUSG00000014030
AA Change: A120V

Domain	Start	End	E-Value	Type
PAX	16	140	4.92e-96	SMART
SCOP:d1ftt__	177	211	1e-4	SMART
Pfam:Pax2_C	233	347	7.3e-55	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000172866
AA Change: A64V

SMART Domains

Protein: ENSMUSP00000134119
Gene: ENSMUSG00000014030
AA Change: A64V

Domain	Start	End	E-Value	Type
PAX	4	85	2.44e-27	SMART
low complexity region	102	134	N/A	INTRINSIC
SCOP:d1ftt__	165	199	7e-5	SMART
Pfam:Pax2_C	224	335	2.3e-53	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000174319
AA Change: A64V

SMART Domains

Protein: ENSMUSP00000133978
Gene: ENSMUSG00000014030
AA Change: A64V

Domain	Start	End	E-Value	Type
PAX	4	85	2.44e-27	SMART
low complexity region	102	134	N/A	INTRINSIC
SCOP:d1ftt__	165	199	2e-4	SMART
low complexity region	251	270	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191036

Predicted Effect

probably benign
Transcript: ENSMUST00000173733

SMART Domains

Protein: ENSMUSP00000133671
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	16	120	2.93e-30	SMART
SCOP:d1ftt__	154	188	1e-4	SMART
Pfam:Pax2_C	212	290	8.7e-28	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000186542

SMART Domains

Protein: ENSMUSP00000141186
Gene: ENSMUSG00000014030

Domain	Start	End	E-Value	Type
PAX	15	108	1.2e-22	SMART

Meta Mutation Damage Score

0.2915

Coding Region Coverage

1x: 98.1%
3x: 97.0%
10x: 94.3%
20x: 88.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the paired box (PAX) family of transcription factors. The central feature of this gene family is a novel, highly conserved DNA-binding motif, known as the paired box. Paired box transcription factors are important regulators in early development, and alterations in the expression of their genes are thought to contribute to neoplastic transformation. This gene encodes the B-cell lineage specific activator protein that is expressed at early, but not late stages of B-cell differentiation. Its expression has also been detected in developing CNS and testis and so the encoded protein may also play a role in neural development and spermatogenesis. This gene is located at 9p13, which is involved in t(9;14)(p13;q32) translocations recurring in small lymphocytic lymphomas of the plasmacytoid subtype, and in derived large-cell lymphomas. This translocation brings the potent E-mu enhancer of the IgH gene into close proximity of the PAX5 promoter, suggesting that the deregulation of transcription of this gene contributes to the pathogenesis of these lymphomas. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
PHENOTYPE: Null mutants exhibit impaired development of the midbrain resulting in a reduced inferior colliculus and an altered cerebellar folial pattern, failure of B cell differentiation, runting, and high postnatal mortality with few survivors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgre4	G	A	17: 56,159,288 (GRCm39)	V658I	probably benign	Het
Ccdc40	T	C	11: 119,122,944 (GRCm39)	Y249H	possibly damaging	Het
D6Ertd527e	C	G	6: 87,088,506 (GRCm39)	T223S	unknown	Homo
Gbp4	G	A	5: 105,268,972 (GRCm39)	R394C	possibly damaging	Het
Gpr183	C	A	14: 122,191,888 (GRCm39)	C211F	probably damaging	Homo
Lcp1	A	T	14: 75,464,446 (GRCm39)	I556F	possibly damaging	Het
Letm1	G	A	5: 33,904,788 (GRCm39)	P513S	probably benign	Het
Letm1	G	A	5: 33,904,790 (GRCm39)	P512L	probably benign	Het
Msh3	A	G	13: 92,483,294 (GRCm39)	V283A	possibly damaging	Het
Nfkb2	G	T	19: 46,296,006 (GRCm39)	E170D	probably benign	Het
Npr3	C	A	15: 11,848,649 (GRCm39)	M439I	probably benign	Het
Or5m10	A	T	2: 85,717,782 (GRCm39)	I213F	possibly damaging	Het
Or5m9	A	T	2: 85,877,399 (GRCm39)	H191L	probably benign	Het
Plcb1	A	G	2: 135,179,419 (GRCm39)	Y609C	probably damaging	Het
Plxna1	G	A	6: 89,334,318 (GRCm39)	H104Y	probably benign	Homo
Rnf213	A	T	11: 119,305,295 (GRCm39)	I509F	probably damaging	Het
Ryr2	T	C	13: 11,884,042 (GRCm39)	S213G	probably damaging	Homo
Spint1	A	G	2: 119,076,096 (GRCm39)	T231A	probably damaging	Het
Tbcel	C	A	9: 42,355,796 (GRCm39)	C139F	probably benign	Het
Thbs2	A	C	17: 14,900,235 (GRCm39)	S573A	probably benign	Het
Tmem43	C	A	6: 91,459,300 (GRCm39)	P257Q	probably benign	Homo
Tmprss13	A	G	9: 45,248,430 (GRCm39)		probably null	Het
Tnc	C	T	4: 63,936,249 (GRCm39)	G229D	probably damaging	Homo
Ugt1a10	TTCATCA	TTCA	1: 88,143,880 (GRCm39)		probably benign	Het
Vmn1r196	T	A	13: 22,478,006 (GRCm39)	V215D	probably damaging	Homo
Vmn1r22	G	T	6: 57,877,317 (GRCm39)	T220K	probably benign	Homo
Vmn2r116	G	A	17: 23,606,253 (GRCm39)	M388I	possibly damaging	Het
Zap70	A	G	1: 36,809,892 (GRCm39)	M1V	probably null	Homo
Zfp282	A	G	6: 47,874,815 (GRCm39)	D340G	probably damaging	Homo
Zfp282	T	A	6: 47,881,987 (GRCm39)	I558N	possibly damaging	Homo

Other mutations in Pax5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02369:Pax5	APN	4	44,691,919 (GRCm39)	missense	probably damaging	1.00
IGL02700:Pax5	APN	4	44,682,722 (GRCm39)	missense	probably damaging	0.99
IGL02754:Pax5	APN	4	44,570,059 (GRCm39)	missense	probably damaging	0.96
apple	UTSW	4	0 ()	unclassified
Denim	UTSW	4	44,645,661 (GRCm39)	nonsense	probably null
Glacier	UTSW	4	44,679,494 (GRCm39)	missense	probably damaging	1.00
glacier2	UTSW	4	44,710,407 (GRCm39)	start codon destroyed	probably null	0.96
Glacier3	UTSW	4	44,679,526 (GRCm39)	missense	probably damaging	1.00
jeans	UTSW	4	44,645,621 (GRCm39)	missense	probably benign	0.03
k2	UTSW	4	44,697,630 (GRCm39)	missense	probably damaging	1.00
menshevik	UTSW	4	44,570,071 (GRCm39)	missense	probably damaging	1.00
Son_of_apple	UTSW	4	44,710,583 (GRCm39)	unclassified	probably benign
R0411:Pax5	UTSW	4	44,609,783 (GRCm39)	missense	probably damaging	0.99
R0415:Pax5	UTSW	4	44,691,886 (GRCm39)	missense	probably damaging	1.00
R0655:Pax5	UTSW	4	44,537,462 (GRCm39)	missense	probably damaging	0.97
R1146:Pax5	UTSW	4	44,697,512 (GRCm39)	splice site	probably benign
R1752:Pax5	UTSW	4	44,609,729 (GRCm39)	missense	probably damaging	1.00
R1891:Pax5	UTSW	4	44,691,859 (GRCm39)	missense	probably damaging	1.00
R4766:Pax5	UTSW	4	44,679,494 (GRCm39)	missense	probably damaging	1.00
R4783:Pax5	UTSW	4	44,570,086 (GRCm39)	missense	probably damaging	1.00
R5134:Pax5	UTSW	4	44,710,407 (GRCm39)	start codon destroyed	probably null	0.96
R5341:Pax5	UTSW	4	44,697,630 (GRCm39)	missense	probably damaging	1.00
R5458:Pax5	UTSW	4	44,679,526 (GRCm39)	missense	probably damaging	1.00
R6281:Pax5	UTSW	4	44,691,955 (GRCm39)	missense	probably benign	0.37
R6871:Pax5	UTSW	4	44,710,583 (GRCm39)	unclassified	probably benign
R7025:Pax5	UTSW	4	44,679,501 (GRCm39)	nonsense	probably null
R7204:Pax5	UTSW	4	44,679,485 (GRCm39)	missense	possibly damaging	0.93
R7975:Pax5	UTSW	4	44,537,465 (GRCm39)	missense	probably damaging	0.98
R8246:Pax5	UTSW	4	44,570,027 (GRCm39)	missense	probably benign	0.08
R8527:Pax5	UTSW	4	44,570,071 (GRCm39)	missense	probably damaging	1.00
R8542:Pax5	UTSW	4	44,570,071 (GRCm39)	missense	probably damaging	1.00
R8836:Pax5	UTSW	4	44,645,621 (GRCm39)	missense	probably benign	0.03
R8847:Pax5	UTSW	4	44,691,865 (GRCm39)	missense	probably benign	0.15
R8987:Pax5	UTSW	4	44,645,661 (GRCm39)	nonsense	probably null
R9404:Pax5	UTSW	4	44,645,565 (GRCm39)	missense	possibly damaging	0.80
X0018:Pax5	UTSW	4	44,691,880 (GRCm39)	missense	probably damaging	1.00
Z1176:Pax5	UTSW	4	44,697,678 (GRCm39)	missense	probably damaging	1.00
Z1177:Pax5	UTSW	4	44,697,558 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAGCGGCCTGGATATTGG -3'
(R):5'- CATGGCTAACTATGGTCCTCTC -3'

Sequencing Primer
(F):5'- GATGTCCTCTCCCAGTAGCTGAG -3'
(R):5'- CCTCTTGGGTCTAGGTATTATGAGAC -3'

Posted On

2016-05-10