Incidental Mutation 'R4692:Cenpe'
ID 354964
Institutional Source Beutler Lab
Gene Symbol Cenpe
Ensembl Gene ENSMUSG00000045328
Gene Name centromere protein E
Synonyms 312kDa, Kif10, N-7 kinesin, CENP-E
MMRRC Submission 041943-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4692 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 134918324-134979301 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 134922140 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 66 (I66V)
Ref Sequence ENSEMBL: ENSMUSP00000057938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062893]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000062893
AA Change: I66V

PolyPhen 2 Score 0.294 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000057938
Gene: ENSMUSG00000045328
AA Change: I66V

DomainStartEndE-ValueType
KISc 4 337 2.4e-172 SMART
coiled coil region 493 612 N/A INTRINSIC
coiled coil region 637 752 N/A INTRINSIC
internal_repeat_1 768 801 3.5e-5 PROSPERO
coiled coil region 821 991 N/A INTRINSIC
low complexity region 1119 1143 N/A INTRINSIC
internal_repeat_2 1225 1238 6.26e-5 PROSPERO
low complexity region 1446 1467 N/A INTRINSIC
low complexity region 1480 1498 N/A INTRINSIC
internal_repeat_2 1614 1627 6.26e-5 PROSPERO
internal_repeat_1 2018 2051 3.5e-5 PROSPERO
coiled coil region 2226 2247 N/A INTRINSIC
coiled coil region 2316 2363 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Centrosome-associated protein E (CENPE) is a kinesin-like motor protein that accumulates in the G2 phase of the cell cycle. Unlike other centrosome-associated proteins, it is not present during interphase and first appears at the centromere region of chromosomes during prometaphase. This protein is required for stable spindle microtubule capture at kinetochores which is a necessary step in chromosome alignment during prometaphase. This protein also couples chromosome position to microtubule depolymerizing activity. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display early embryonic lethality. Mutant embryos grown in culture exhibit inner cell mass growth defects and mitotic chromosome misalignment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310057J18Rik A T 10: 28,849,882 (GRCm39) Y230* probably null Het
9230104M06Rik A T 12: 112,963,692 (GRCm39) probably benign Het
Arhgap20 A G 9: 51,697,088 (GRCm39) D53G probably damaging Het
Arl2 T C 19: 6,187,776 (GRCm39) T54A probably damaging Het
Baz2a G A 10: 127,960,762 (GRCm39) G1521S probably damaging Het
Begain A G 12: 108,999,818 (GRCm39) S523P probably damaging Het
Car10 T C 11: 93,075,984 (GRCm39) probably null Het
Col14a1 T A 15: 55,286,864 (GRCm39) V895E unknown Het
Coro1b T C 19: 4,199,418 (GRCm39) Y26H probably damaging Het
Crebbp T C 16: 3,932,727 (GRCm39) E1017G possibly damaging Het
Cwf19l2 T C 9: 3,428,709 (GRCm39) S232P probably damaging Het
Cyp7b1 T A 3: 18,126,728 (GRCm39) I473F probably damaging Het
Efcab5 A T 11: 77,004,507 (GRCm39) I937N probably damaging Het
Fam53c A C 18: 34,901,743 (GRCm39) E220A probably damaging Het
Gsn A G 2: 35,188,883 (GRCm39) Y434C probably damaging Het
Igkv2-137 T C 6: 67,532,971 (GRCm39) S45P possibly damaging Het
Katnip T C 7: 125,466,841 (GRCm39) probably null Het
Kif13b C A 14: 65,041,024 (GRCm39) T1704K probably benign Het
Mapk7 A G 11: 61,380,068 (GRCm39) S697P possibly damaging Het
Mrgpra1 T A 7: 46,985,446 (GRCm39) I78F probably damaging Het
N6amt1 T C 16: 87,153,854 (GRCm39) V97A possibly damaging Het
Oas3 T C 5: 120,907,420 (GRCm39) T406A probably benign Het
Or4f61 A G 2: 111,923,026 (GRCm39) S7P probably damaging Het
Or8c17 C T 9: 38,179,826 (GRCm39) Q6* probably null Het
Paxip1 T C 5: 27,977,095 (GRCm39) probably benign Het
Pfn4 A T 12: 4,824,486 (GRCm39) Y71F probably damaging Het
Plin4 C A 17: 56,410,762 (GRCm39) G1090C probably damaging Het
Ptk2b C T 14: 66,394,518 (GRCm39) G859S probably benign Het
Rbl2 T A 8: 91,849,047 (GRCm39) D1084E probably damaging Het
Robo1 T G 16: 72,757,090 (GRCm39) S350R probably damaging Het
Sbno2 A G 10: 79,922,161 (GRCm39) V4A possibly damaging Het
Sh3rf1 T C 8: 61,806,888 (GRCm39) probably null Het
Smgc T C 15: 91,738,764 (GRCm39) V474A possibly damaging Het
Snx13 A G 12: 35,136,917 (GRCm39) D126G possibly damaging Het
Sox9 C A 11: 112,673,803 (GRCm39) H131Q probably benign Het
Spag6 T C 2: 18,704,054 (GRCm39) I34T probably benign Het
Speer2 T A 16: 69,654,860 (GRCm39) T202S possibly damaging Het
Sspo T A 6: 48,459,621 (GRCm39) C3327S probably damaging Het
Vcpip1 G T 1: 9,818,299 (GRCm39) A28E unknown Het
Vstm5 A T 9: 15,168,718 (GRCm39) D94V probably damaging Het
Zfp329 T C 7: 12,544,559 (GRCm39) K322E probably damaging Het
Zfp932 G A 5: 110,157,052 (GRCm39) G250D probably damaging Het
Zscan26 A G 13: 21,629,427 (GRCm39) C359R probably damaging Het
Other mutations in Cenpe
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00655:Cenpe APN 3 134,937,216 (GRCm39) critical splice donor site probably null
IGL00799:Cenpe APN 3 134,934,678 (GRCm39) critical splice donor site probably null
IGL00815:Cenpe APN 3 134,965,112 (GRCm39) missense probably benign
IGL01446:Cenpe APN 3 134,943,300 (GRCm39) missense probably benign 0.01
IGL01469:Cenpe APN 3 134,934,567 (GRCm39) missense probably damaging 1.00
IGL01843:Cenpe APN 3 134,924,268 (GRCm39) missense possibly damaging 0.88
IGL02254:Cenpe APN 3 134,961,238 (GRCm39) missense probably benign
IGL02337:Cenpe APN 3 134,926,037 (GRCm39) splice site probably benign
IGL02382:Cenpe APN 3 134,953,147 (GRCm39) missense probably benign
IGL02458:Cenpe APN 3 134,935,869 (GRCm39) nonsense probably null
IGL02934:Cenpe APN 3 134,970,112 (GRCm39) missense probably damaging 1.00
IGL03335:Cenpe APN 3 134,949,386 (GRCm39) missense probably benign
R0086:Cenpe UTSW 3 134,970,185 (GRCm39) splice site probably benign
R0173:Cenpe UTSW 3 134,965,744 (GRCm39) missense probably benign 0.00
R0394:Cenpe UTSW 3 134,922,186 (GRCm39) splice site probably benign
R0411:Cenpe UTSW 3 134,928,016 (GRCm39) missense probably damaging 1.00
R0624:Cenpe UTSW 3 134,952,347 (GRCm39) missense probably benign 0.00
R0634:Cenpe UTSW 3 134,952,588 (GRCm39) missense probably damaging 1.00
R0648:Cenpe UTSW 3 134,935,843 (GRCm39) missense probably damaging 1.00
R0691:Cenpe UTSW 3 134,923,066 (GRCm39) missense probably damaging 1.00
R1184:Cenpe UTSW 3 134,970,183 (GRCm39) critical splice donor site probably null
R1530:Cenpe UTSW 3 134,952,663 (GRCm39) missense possibly damaging 0.92
R1559:Cenpe UTSW 3 134,976,661 (GRCm39) missense probably benign 0.07
R1562:Cenpe UTSW 3 134,944,155 (GRCm39) missense possibly damaging 0.53
R1568:Cenpe UTSW 3 134,945,519 (GRCm39) missense probably benign 0.01
R1712:Cenpe UTSW 3 134,971,694 (GRCm39) missense probably damaging 0.99
R1828:Cenpe UTSW 3 134,952,257 (GRCm39) missense probably damaging 0.99
R1846:Cenpe UTSW 3 134,945,606 (GRCm39) missense probably damaging 1.00
R1861:Cenpe UTSW 3 134,974,740 (GRCm39) missense probably damaging 1.00
R1938:Cenpe UTSW 3 134,953,240 (GRCm39) missense probably damaging 0.98
R1961:Cenpe UTSW 3 134,948,254 (GRCm39) missense probably damaging 1.00
R2062:Cenpe UTSW 3 134,928,082 (GRCm39) splice site probably benign
R2118:Cenpe UTSW 3 134,952,645 (GRCm39) missense possibly damaging 0.94
R2127:Cenpe UTSW 3 134,945,541 (GRCm39) missense probably benign 0.08
R2156:Cenpe UTSW 3 134,953,235 (GRCm39) missense probably benign 0.34
R2265:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2268:Cenpe UTSW 3 134,967,397 (GRCm39) missense probably benign 0.02
R2392:Cenpe UTSW 3 134,953,874 (GRCm39) missense probably damaging 1.00
R2508:Cenpe UTSW 3 134,946,834 (GRCm39) missense possibly damaging 0.92
R3084:Cenpe UTSW 3 134,946,782 (GRCm39) missense probably damaging 1.00
R3779:Cenpe UTSW 3 134,962,337 (GRCm39) missense possibly damaging 0.87
R3833:Cenpe UTSW 3 134,928,083 (GRCm39) splice site probably benign
R3974:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R3975:Cenpe UTSW 3 134,944,233 (GRCm39) critical splice donor site probably null
R3975:Cenpe UTSW 3 134,940,986 (GRCm39) splice site probably null
R4151:Cenpe UTSW 3 134,920,914 (GRCm39) missense probably benign 0.36
R4166:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R4581:Cenpe UTSW 3 134,952,761 (GRCm39) missense probably benign 0.30
R4622:Cenpe UTSW 3 134,949,469 (GRCm39) missense probably benign 0.22
R4769:Cenpe UTSW 3 134,953,912 (GRCm39) missense probably benign
R4976:Cenpe UTSW 3 134,940,637 (GRCm39) missense probably damaging 1.00
R4983:Cenpe UTSW 3 134,940,689 (GRCm39) missense probably damaging 1.00
R4990:Cenpe UTSW 3 134,962,401 (GRCm39) missense probably damaging 1.00
R5002:Cenpe UTSW 3 134,952,842 (GRCm39) missense probably benign
R5057:Cenpe UTSW 3 134,926,074 (GRCm39) missense probably benign 0.14
R5063:Cenpe UTSW 3 134,976,715 (GRCm39) missense probably damaging 0.99
R5181:Cenpe UTSW 3 134,948,064 (GRCm39) missense probably damaging 0.99
R5281:Cenpe UTSW 3 134,935,911 (GRCm39) missense possibly damaging 0.89
R5389:Cenpe UTSW 3 134,965,149 (GRCm39) critical splice donor site probably null
R5517:Cenpe UTSW 3 134,929,026 (GRCm39) missense probably damaging 1.00
R5521:Cenpe UTSW 3 134,974,826 (GRCm39) missense probably damaging 1.00
R5607:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5608:Cenpe UTSW 3 134,940,837 (GRCm39) nonsense probably null
R5627:Cenpe UTSW 3 134,941,234 (GRCm39) missense possibly damaging 0.51
R5766:Cenpe UTSW 3 134,954,174 (GRCm39) missense probably damaging 0.96
R5783:Cenpe UTSW 3 134,967,341 (GRCm39) missense probably benign 0.00
R5933:Cenpe UTSW 3 134,967,389 (GRCm39) missense probably benign 0.03
R6073:Cenpe UTSW 3 134,965,834 (GRCm39) nonsense probably null
R6163:Cenpe UTSW 3 134,974,764 (GRCm39) missense probably damaging 0.99
R6192:Cenpe UTSW 3 134,954,291 (GRCm39) missense possibly damaging 0.93
R6224:Cenpe UTSW 3 134,949,536 (GRCm39) missense possibly damaging 0.87
R6313:Cenpe UTSW 3 134,935,936 (GRCm39) missense probably benign 0.26
R6326:Cenpe UTSW 3 134,945,539 (GRCm39) missense probably benign 0.15
R6383:Cenpe UTSW 3 134,957,289 (GRCm39) missense probably damaging 1.00
R6418:Cenpe UTSW 3 134,957,305 (GRCm39) missense probably damaging 0.99
R6797:Cenpe UTSW 3 134,943,899 (GRCm39) missense possibly damaging 0.92
R6810:Cenpe UTSW 3 134,949,583 (GRCm39) missense probably benign 0.00
R6989:Cenpe UTSW 3 134,940,888 (GRCm39) missense probably damaging 1.00
R7009:Cenpe UTSW 3 134,940,963 (GRCm39) missense probably benign 0.02
R7009:Cenpe UTSW 3 134,940,962 (GRCm39) missense probably damaging 0.97
R7039:Cenpe UTSW 3 134,961,217 (GRCm39) missense probably benign 0.28
R7387:Cenpe UTSW 3 134,952,798 (GRCm39) missense probably benign 0.05
R7470:Cenpe UTSW 3 134,947,916 (GRCm39) missense probably damaging 1.00
R7535:Cenpe UTSW 3 134,949,523 (GRCm39) missense possibly damaging 0.90
R7562:Cenpe UTSW 3 134,954,395 (GRCm39) missense probably damaging 1.00
R7573:Cenpe UTSW 3 134,953,220 (GRCm39) missense probably damaging 1.00
R7613:Cenpe UTSW 3 134,948,063 (GRCm39) missense possibly damaging 0.90
R7741:Cenpe UTSW 3 134,953,096 (GRCm39) splice site probably null
R7771:Cenpe UTSW 3 134,946,702 (GRCm39) splice site probably null
R7843:Cenpe UTSW 3 134,938,720 (GRCm39) nonsense probably null
R7973:Cenpe UTSW 3 134,929,011 (GRCm39) missense probably damaging 1.00
R8036:Cenpe UTSW 3 134,945,609 (GRCm39) frame shift probably null
R8069:Cenpe UTSW 3 134,949,479 (GRCm39) missense probably damaging 1.00
R8151:Cenpe UTSW 3 134,952,783 (GRCm39) missense probably benign 0.28
R8176:Cenpe UTSW 3 134,935,851 (GRCm39) missense probably damaging 1.00
R8191:Cenpe UTSW 3 134,957,375 (GRCm39) missense probably benign
R8251:Cenpe UTSW 3 134,957,445 (GRCm39) critical splice donor site probably null
R8425:Cenpe UTSW 3 134,948,388 (GRCm39) nonsense probably null
R8488:Cenpe UTSW 3 134,965,002 (GRCm39) missense probably damaging 1.00
R8811:Cenpe UTSW 3 134,929,001 (GRCm39) missense probably damaging 1.00
R8850:Cenpe UTSW 3 134,930,777 (GRCm39) missense probably damaging 1.00
R8879:Cenpe UTSW 3 134,965,862 (GRCm39) missense probably damaging 0.99
R8899:Cenpe UTSW 3 134,945,644 (GRCm39) missense probably benign 0.18
R9035:Cenpe UTSW 3 134,976,572 (GRCm39) missense probably benign 0.01
R9038:Cenpe UTSW 3 134,923,797 (GRCm39) missense probably benign 0.00
R9093:Cenpe UTSW 3 134,945,641 (GRCm39) nonsense probably null
R9221:Cenpe UTSW 3 134,935,839 (GRCm39) missense possibly damaging 0.90
R9365:Cenpe UTSW 3 134,954,207 (GRCm39) missense possibly damaging 0.56
R9443:Cenpe UTSW 3 134,976,609 (GRCm39) missense probably damaging 0.99
Z1177:Cenpe UTSW 3 134,922,146 (GRCm39) missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CCATTACATTTTCCCTGTGAGAAGG -3'
(R):5'- TGATGCAGTTTGTCCATAGGC -3'

Sequencing Primer
(F):5'- TGAGAAGGGTGTTTTCTGAAAAGAC -3'
(R):5'- GCAGTTTGTCCATAGGCAAATATAG -3'
Posted On 2015-10-21