Incidental Mutation 'R4467:Has1'
ID 329255
Institutional Source Beutler Lab
Gene Symbol Has1
Ensembl Gene ENSMUSG00000003665
Gene Name hyaluronan synthase 1
Synonyms
MMRRC Submission 041724-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4467 (G1)
Quality Score 218
Status Validated
Chromosome 17
Chromosomal Location 18063588-18075450 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 18064257 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 461 (V461M)
Ref Sequence ENSEMBL: ENSMUSP00000003762 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003762] [ENSMUST00000139969] [ENSMUST00000172097] [ENSMUST00000226899]
AlphaFold Q61647
Predicted Effect probably benign
Transcript: ENSMUST00000003762
AA Change: V461M

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000003762
Gene: ENSMUSG00000003665
AA Change: V461M

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 53 75 N/A INTRINSIC
low complexity region 78 86 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 179 387 1.1e-21 PFAM
Pfam:Glyco_transf_21 205 386 1.2e-8 PFAM
Pfam:Chitin_synth_2 222 394 1.6e-16 PFAM
Pfam:Glyco_trans_2_3 237 453 5.6e-16 PFAM
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 544 566 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052338
Predicted Effect probably benign
Transcript: ENSMUST00000139969
SMART Domains Protein: ENSMUSP00000119658
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:IG 151 186 1e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000154301
SMART Domains Protein: ENSMUSP00000117377
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
Blast:IG 27 78 2e-32 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172097
SMART Domains Protein: ENSMUSP00000128732
Gene: ENSMUSG00000080316

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IG 171 260 2.08e-1 SMART
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178888
Predicted Effect noncoding transcript
Transcript: ENSMUST00000179350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232410
Predicted Effect probably benign
Transcript: ENSMUST00000226899
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 98% (52/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hyaluronan or hyaluronic acid (HA) is a high molecular weight unbranched polysaccharide synthesized by a wide variety of organisms from bacteria to mammals, and is a constituent of the extracellular matrix. It consists of alternating glucuronic acid and N-acetylglucosamine residues that are linked by beta-1-3 and beta-1-4 glycosidic bonds. HA is synthesized by membrane-bound synthase at the inner surface of the plasma membrane, and the chains are extruded through pore-like structures into the extracellular space. It serves a variety of functions, including space filling, lubrication of joints, and provision of a matrix through which cells can migrate. HA is actively produced during wound healing and tissue repair to provide a framework for ingrowth of blood vessels and fibroblasts. Changes in the serum concentration of HA are associated with inflammatory and degenerative arthropathies such as rheumatoid arthritis. In addition, the interaction of HA with the leukocyte receptor CD44 is important in tissue-specific homing by leukocytes, and overexpression of HA receptors has been correlated with tumor metastasis. HAS1 is a member of the newly identified vertebrate gene family encoding putative hyaluronan synthases, and its amino acid sequence shows significant homology to the hasA gene product of Streptococcus pyogenes, a glycosaminoglycan synthetase (DG42) from Xenopus laevis, and a recently described murine hyaluronan synthase. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and appear grossly normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik G T 5: 64,056,182 (GRCm39) probably benign Het
Atg4a-ps A G 3: 103,553,171 (GRCm39) Y57H probably damaging Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
Bms1 G A 6: 118,360,808 (GRCm39) T1220I probably damaging Het
Brat1 T C 5: 140,690,826 (GRCm39) probably benign Het
Cds2 T A 2: 132,136,366 (GRCm39) Y39* probably null Het
Chrnd T A 1: 87,125,099 (GRCm39) L384Q probably damaging Het
Cpa3 A T 3: 20,282,981 (GRCm39) Y155* probably null Het
Crlf1 G A 8: 70,953,606 (GRCm39) W260* probably null Het
Cux1 C G 5: 136,341,576 (GRCm39) E605D probably damaging Het
Cylc2 C G 4: 51,229,651 (GRCm39) T331R unknown Het
Dmtf1 T C 5: 9,186,085 (GRCm39) N167S probably damaging Het
Dnaaf9 A G 2: 130,609,567 (GRCm39) I372T probably damaging Het
Dnai7 A T 6: 145,128,944 (GRCm39) probably null Het
Dtx2 T A 5: 136,040,930 (GRCm39) W112R probably damaging Het
Elf3 A G 1: 135,184,582 (GRCm39) I138T probably damaging Het
F11 T A 8: 45,694,511 (GRCm39) I617F probably damaging Het
Fdps A T 3: 89,008,093 (GRCm39) D8E possibly damaging Het
Fzd10 C A 5: 128,678,340 (GRCm39) T20K probably benign Het
Gm9978 T A 10: 78,322,750 (GRCm39) noncoding transcript Het
Gpr158 T A 2: 21,831,810 (GRCm39) M970K probably damaging Het
Hdac3 C T 18: 38,085,566 (GRCm39) G80D probably benign Het
Klk12 A T 7: 43,422,807 (GRCm39) R245W probably damaging Het
Lamp5 A G 2: 135,900,940 (GRCm39) I47V probably damaging Het
Or6c1b T C 10: 129,272,933 (GRCm39) I84T probably benign Het
Ovgp1 A G 3: 105,885,027 (GRCm39) D122G probably benign Het
Piezo1 T C 8: 123,213,135 (GRCm39) E1875G probably benign Het
Pih1d1 A G 7: 44,807,921 (GRCm39) M132V possibly damaging Het
Pon2 C T 6: 5,267,021 (GRCm39) A241T probably benign Het
Prkce A G 17: 86,927,339 (GRCm39) I538V possibly damaging Het
Rab36 C T 10: 74,887,875 (GRCm39) R249* probably null Het
Rps6kl1 C T 12: 85,194,582 (GRCm39) A110T probably damaging Het
Rsad1 T C 11: 94,435,356 (GRCm39) T244A probably benign Het
Slc22a7 T C 17: 46,743,436 (GRCm39) I532V probably benign Het
Slc2a7 T C 4: 150,247,731 (GRCm39) V377A possibly damaging Het
Slx4 A G 16: 3,806,919 (GRCm39) V508A possibly damaging Het
Stag2 A G X: 41,322,749 (GRCm39) S400G probably benign Het
Stat6 T G 10: 127,487,097 (GRCm39) I201M probably damaging Het
Stim2 T C 5: 54,273,536 (GRCm39) probably null Het
Tbc1d9 A G 8: 83,937,107 (GRCm39) Y63C probably damaging Het
Tctn2 T C 5: 124,758,252 (GRCm39) noncoding transcript Het
Tmem181a T A 17: 6,346,061 (GRCm39) L185H probably damaging Het
Ubr5 T A 15: 38,004,580 (GRCm39) T1282S probably damaging Het
Ufl1 A T 4: 25,254,806 (GRCm39) I550N probably damaging Het
Uty A G Y: 1,158,372 (GRCm39) V557A possibly damaging Het
Vmn1r54 T C 6: 90,246,253 (GRCm39) S56P probably damaging Het
Zfp980 G A 4: 145,428,653 (GRCm39) G461S probably benign Het
Other mutations in Has1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Has1 APN 17 18,063,924 (GRCm39) unclassified probably benign
IGL02551:Has1 APN 17 18,068,560 (GRCm39) missense probably damaging 1.00
R0149:Has1 UTSW 17 18,070,433 (GRCm39) missense probably damaging 1.00
R0496:Has1 UTSW 17 18,064,008 (GRCm39) missense probably benign
R0637:Has1 UTSW 17 18,064,125 (GRCm39) missense possibly damaging 0.67
R1051:Has1 UTSW 17 18,068,541 (GRCm39) missense probably damaging 1.00
R1647:Has1 UTSW 17 18,070,247 (GRCm39) missense probably damaging 1.00
R1648:Has1 UTSW 17 18,070,247 (GRCm39) missense probably damaging 1.00
R1768:Has1 UTSW 17 18,070,562 (GRCm39) missense probably benign
R2016:Has1 UTSW 17 18,068,532 (GRCm39) missense probably damaging 1.00
R3810:Has1 UTSW 17 18,067,822 (GRCm39) missense probably damaging 0.98
R4235:Has1 UTSW 17 18,070,298 (GRCm39) missense possibly damaging 0.62
R5475:Has1 UTSW 17 18,068,583 (GRCm39) missense possibly damaging 0.57
R5682:Has1 UTSW 17 18,064,425 (GRCm39) missense possibly damaging 0.58
R6418:Has1 UTSW 17 18,070,207 (GRCm39) missense probably damaging 1.00
R6841:Has1 UTSW 17 18,064,122 (GRCm39) missense probably benign 0.06
R7076:Has1 UTSW 17 18,064,068 (GRCm39) missense probably damaging 1.00
R7767:Has1 UTSW 17 18,070,792 (GRCm39) missense probably damaging 1.00
R8878:Has1 UTSW 17 18,070,321 (GRCm39) missense possibly damaging 0.57
R9002:Has1 UTSW 17 18,063,912 (GRCm39) missense unknown
R9502:Has1 UTSW 17 18,063,971 (GRCm39) missense probably damaging 1.00
X0028:Has1 UTSW 17 18,070,715 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCAAGGTGGTAGGCTTCAG -3'
(R):5'- GCATGGATGACCTATGAAGCGG -3'

Sequencing Primer
(F):5'- GCCTCCAAGCAGCAGTAGAG -3'
(R):5'- ACCTATGAAGCGGTGGTCTC -3'
Posted On 2015-07-21