Incidental Mutation 'R4418:Trappc10'
ID326948
Institutional Source Beutler Lab
Gene Symbol Trappc10
Ensembl Gene ENSMUSG00000000374
Gene Nametrafficking protein particle complex 10
SynonymsTmem1, LOC380642, B230307C21Rik
MMRRC Submission 041139-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R4418 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78186725-78244641 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 78217188 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 251 (A251D)
Ref Sequence ENSEMBL: ENSMUSP00000000384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000384] [ENSMUST00000217980]
Predicted Effect probably damaging
Transcript: ENSMUST00000000384
AA Change: A251D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000384
Gene: ENSMUSG00000000374
AA Change: A251D

DomainStartEndE-ValueType
Pfam:TRAPPC10 1016 1245 1.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217980
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit cardiovascular phenotypes, including atrioventricular or ventricular septal defects, thymus hypoplasia, and eye defects such as microphthalmia or anophthalmia. Holoprosencephaly, anencephaly and severe craniofacial defects may be also present. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,261,287 probably null Het
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A T 7: 131,247,465 D899V possibly damaging Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1113W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dclre1c T C 2: 3,452,935 F285S possibly damaging Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Dync1li1 T A 9: 114,706,170 S167R probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 probably benign Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E314G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I103N probably damaging Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kcnk2 G A 1: 189,256,727 R207C probably damaging Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 probably benign Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nek1 T C 8: 61,106,864 F1007S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Opn1sw G A 6: 29,379,424 R45* probably null Het
Osbpl5 A T 7: 143,709,815 C98* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F155L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Qser1 A T 2: 104,789,421 S349T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpl21-ps4 A G 14: 11,227,879 noncoding transcript Het
Rxfp2 A T 5: 150,048,800 H158L probably benign Het
Ryr3 C T 2: 112,831,224 C1807Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Stil A G 4: 115,009,377 N176S probably benign Het
Tap1 T A 17: 34,188,379 probably null Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 probably benign Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L583F probably damaging Het
Wasf1 C T 10: 40,936,582 H456Y unknown Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in Trappc10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Trappc10 APN 10 78203877 splice site probably benign
IGL01375:Trappc10 APN 10 78188899 missense possibly damaging 0.75
IGL01413:Trappc10 APN 10 78197844 missense possibly damaging 0.87
IGL02413:Trappc10 APN 10 78210776 missense probably damaging 0.99
IGL03037:Trappc10 APN 10 78199035 unclassified probably benign
IGL03094:Trappc10 APN 10 78228920 splice site probably benign
IGL03164:Trappc10 APN 10 78220242 missense probably damaging 1.00
IGL03351:Trappc10 APN 10 78188761 missense probably damaging 1.00
IGL03055:Trappc10 UTSW 10 78214686 missense probably damaging 1.00
IGL03098:Trappc10 UTSW 10 78214686 missense probably damaging 1.00
R0304:Trappc10 UTSW 10 78210760 splice site probably benign
R0605:Trappc10 UTSW 10 78201497 missense possibly damaging 0.70
R1806:Trappc10 UTSW 10 78210776 missense probably damaging 0.99
R1856:Trappc10 UTSW 10 78196451 missense probably benign 0.00
R2045:Trappc10 UTSW 10 78209479 splice site probably benign
R2088:Trappc10 UTSW 10 78196334 missense probably benign 0.00
R2126:Trappc10 UTSW 10 78203924 missense possibly damaging 0.94
R2202:Trappc10 UTSW 10 78199042 critical splice donor site probably null
R2509:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2510:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2511:Trappc10 UTSW 10 78211523 missense possibly damaging 0.51
R2893:Trappc10 UTSW 10 78193401 missense probably benign 0.00
R3744:Trappc10 UTSW 10 78199090 missense probably benign 0.00
R3778:Trappc10 UTSW 10 78200802 missense possibly damaging 0.89
R3876:Trappc10 UTSW 10 78220186 splice site probably null
R3930:Trappc10 UTSW 10 78210403 missense probably benign 0.03
R4078:Trappc10 UTSW 10 78210382 missense probably damaging 1.00
R4111:Trappc10 UTSW 10 78196430 missense probably benign 0.09
R4549:Trappc10 UTSW 10 78231458 missense probably damaging 1.00
R4695:Trappc10 UTSW 10 78197863 missense probably damaging 0.99
R4799:Trappc10 UTSW 10 78201590 missense possibly damaging 0.71
R5022:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5023:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5026:Trappc10 UTSW 10 78204288 missense possibly damaging 0.82
R5057:Trappc10 UTSW 10 78217160 missense possibly damaging 0.72
R5282:Trappc10 UTSW 10 78187860 missense probably damaging 1.00
R5363:Trappc10 UTSW 10 78188840 missense possibly damaging 0.92
R5813:Trappc10 UTSW 10 78222739 missense probably damaging 1.00
R5831:Trappc10 UTSW 10 78209426 missense probably damaging 1.00
R6209:Trappc10 UTSW 10 78214812 missense possibly damaging 0.50
R6450:Trappc10 UTSW 10 78209450 missense possibly damaging 0.92
R6520:Trappc10 UTSW 10 78201453 missense probably benign 0.00
R6533:Trappc10 UTSW 10 78188894 missense probably damaging 0.96
R6767:Trappc10 UTSW 10 78193511 missense possibly damaging 0.75
R6798:Trappc10 UTSW 10 78188831 missense probably benign 0.00
R7205:Trappc10 UTSW 10 78210428 missense probably damaging 1.00
R7282:Trappc10 UTSW 10 78207493 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCAATAGGAATTCGAAGACCC -3'
(R):5'- TGTCCAGTGCTGCTCGAAAG -3'

Sequencing Primer
(F):5'- GGAATTCGAAGACCCTGATAATTTGC -3'
(R):5'- TCCTATGTGAGCGAGTCCTGAC -3'
Posted On2015-07-07