Incidental Mutation 'R4418:Stil'
ID326926
Institutional Source Beutler Lab
Gene Symbol Stil
Ensembl Gene ENSMUSG00000028718
Gene NameScl/Tal1 interrupting locus
SynonymsSil
MMRRC Submission 041139-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4418 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115000159-115043196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115009377 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 176 (N176S)
Ref Sequence ENSEMBL: ENSMUSP00000030490 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030490] [ENSMUST00000129957] [ENSMUST00000141933] [ENSMUST00000147519]
Predicted Effect probably benign
Transcript: ENSMUST00000030490
AA Change: N176S

PolyPhen 2 Score 0.174 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030490
Gene: ENSMUSG00000028718
AA Change: N176S

DomainStartEndE-ValueType
Pfam:STIL_N 22 426 5.1e-199 PFAM
low complexity region 709 724 N/A INTRINSIC
low complexity region 1106 1118 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129957
AA Change: N176S

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123385
Gene: ENSMUSG00000028718
AA Change: N176S

DomainStartEndE-ValueType
Pfam:STIL_N 22 416 1.5e-180 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130401
Predicted Effect probably benign
Transcript: ENSMUST00000141933
AA Change: N176S

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118849
Gene: ENSMUSG00000028718
AA Change: N176S

DomainStartEndE-ValueType
Pfam:STIL_N 22 392 6.6e-166 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147519
SMART Domains Protein: ENSMUSP00000120836
Gene: ENSMUSG00000028718

DomainStartEndE-ValueType
Pfam:STIL_N 1 78 5.3e-34 PFAM
Meta Mutation Damage Score 0.1076 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 95% (72/76)
MGI Phenotype FUNCTION: This gene encodes a centrosomal protein ubiquitously expressed in proliferating cells and during early embryonic development. Mice lacking the encoded protein die in utero with marked growth retardation, defects in the developing neural fold and randomization of left-right asymmetry. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos with various neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,261,287 probably null Het
4930523C07Rik A G 1: 160,044,802 noncoding transcript Het
5430419D17Rik A T 7: 131,247,465 D899V possibly damaging Het
Acot12 A G 13: 91,784,405 T507A possibly damaging Het
Agap2 T G 10: 127,091,650 C1113W probably damaging Het
Ap3s1-ps2 A T 8: 94,405,293 noncoding transcript Het
B3gnt3 T C 8: 71,693,769 R39G probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Chad C T 11: 94,567,837 H271Y possibly damaging Het
Chil4 G A 3: 106,203,727 P284S possibly damaging Het
Col6a1 T A 10: 76,718,405 K323* probably null Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dclre1c T C 2: 3,452,935 F285S possibly damaging Het
Dctn2 T G 10: 127,278,365 M360R probably benign Het
Dgka A T 10: 128,728,094 L462Q probably damaging Het
Drg2 A C 11: 60,468,146 K364T probably damaging Het
Dync1li1 T A 9: 114,706,170 S167R probably damaging Het
Fam189a2 T C 19: 23,979,435 T365A probably benign Het
Fer A T 17: 64,029,291 D554V possibly damaging Het
Fignl2 A G 15: 101,053,949 S151P possibly damaging Het
Gbgt1 A G 2: 28,498,408 Y35C probably damaging Het
Gm6526 T A 14: 43,748,845 I79K probably damaging Het
Gm884 T C 11: 103,618,314 probably benign Het
Gpr6 T G 10: 41,070,608 N326T probably damaging Het
Hcn4 C T 9: 58,843,895 T268M probably benign Het
Hist1h2bc C T 13: 23,684,503 T91M probably damaging Het
Hnf4g A G 3: 3,648,094 M243V possibly damaging Het
Homer1 A G 13: 93,402,069 E314G probably damaging Het
Hs6st1 T C 1: 36,104,027 Y348H probably damaging Het
Ifitm6 A T 7: 141,016,071 I103N probably damaging Het
Ipo5 T G 14: 120,943,893 C944G possibly damaging Het
Kcnb1 C A 2: 167,105,675 E418* probably null Het
Kcnk2 G A 1: 189,256,727 R207C probably damaging Het
Kctd8 T C 5: 69,341,162 E47G probably damaging Het
Klhdc2 C T 12: 69,307,597 probably benign Het
Mgat1 A G 11: 49,261,245 Y185C probably damaging Het
Mmp25 T A 17: 23,644,070 R122S probably damaging Het
Mrpl39 C A 16: 84,725,124 probably null Het
Naip6 C T 13: 100,300,600 A472T probably benign Het
Nek1 T C 8: 61,106,864 F1007S probably damaging Het
Neto1 T C 18: 86,404,856 M146T probably benign Het
Opn1sw G A 6: 29,379,424 R45* probably null Het
Osbpl5 A T 7: 143,709,815 C98* probably null Het
Pcdhb7 C T 18: 37,343,482 A557V probably benign Het
Pecam1 A G 11: 106,695,922 F155L possibly damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Pmfbp1 C A 8: 109,530,633 Q609K probably benign Het
Pnpo A T 11: 96,940,969 probably null Het
Ppp2cb G A 8: 33,617,049 R254Q probably benign Het
Qser1 A T 2: 104,789,421 S349T probably damaging Het
Rnf167 T A 11: 70,647,917 W17R probably damaging Het
Rpl21-ps4 A G 14: 11,227,879 noncoding transcript Het
Rxfp2 A T 5: 150,048,800 H158L probably benign Het
Ryr3 C T 2: 112,831,224 C1807Y probably damaging Het
Scaper T A 9: 55,838,180 E601D probably damaging Het
Secisbp2l A T 2: 125,752,915 C542S probably benign Het
Slc6a19 A G 13: 73,684,395 V393A possibly damaging Het
Tap1 T A 17: 34,188,379 probably null Het
Tcl1b3 A T 12: 105,193,585 Q105L probably damaging Het
Tmem206 T A 1: 191,348,432 V283E probably damaging Het
Trappc10 G T 10: 78,217,188 A251D probably damaging Het
Trim43a G T 9: 88,582,153 C39F probably damaging Het
Ttn A T 2: 76,889,481 probably benign Het
Vmn2r110 A T 17: 20,583,689 L208* probably null Het
Vmn2r88 G T 14: 51,418,081 L583F probably damaging Het
Wasf1 C T 10: 40,936,582 H456Y unknown Het
Zfp120 A G 2: 150,118,185 I73T possibly damaging Het
Zfp990 T C 4: 145,536,728 C99R possibly damaging Het
Other mutations in Stil
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01506:Stil APN 4 115024112 missense probably benign 0.29
IGL01672:Stil APN 4 115032789 missense probably damaging 1.00
IGL02058:Stil APN 4 115014162 missense probably benign 0.00
IGL02076:Stil APN 4 115023637 missense probably benign 0.03
IGL02104:Stil APN 4 115041482 missense probably damaging 1.00
IGL02355:Stil APN 4 115010111 missense probably damaging 1.00
IGL02362:Stil APN 4 115010111 missense probably damaging 1.00
IGL02612:Stil APN 4 115023696 missense possibly damaging 0.80
IGL02695:Stil APN 4 115016175 missense probably damaging 1.00
IGL02696:Stil APN 4 115041495 missense probably damaging 0.99
IGL02826:Stil APN 4 115024098 missense probably benign 0.01
IGL02946:Stil APN 4 115029913 missense probably benign 0.05
IGL03146:Stil APN 4 115024415 missense probably damaging 1.00
R0058:Stil UTSW 4 115041298 missense probably damaging 1.00
R0256:Stil UTSW 4 115023685 missense possibly damaging 0.80
R0324:Stil UTSW 4 115039149 missense probably benign 0.01
R0391:Stil UTSW 4 115041172 critical splice acceptor site probably null
R0602:Stil UTSW 4 115024423 splice site probably benign
R0620:Stil UTSW 4 115007159 missense possibly damaging 0.52
R1452:Stil UTSW 4 115039195 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1462:Stil UTSW 4 115023964 missense probably benign 0.00
R1544:Stil UTSW 4 115023852 missense probably damaging 0.97
R1789:Stil UTSW 4 115041782 missense probably benign 0.01
R1878:Stil UTSW 4 115041226 missense probably damaging 1.00
R1895:Stil UTSW 4 115023875 missense probably benign 0.40
R2325:Stil UTSW 4 115032707 missense probably benign 0.12
R2401:Stil UTSW 4 115016286 missense probably null 0.81
R3054:Stil UTSW 4 115004966 missense probably damaging 1.00
R3055:Stil UTSW 4 115014069 splice site probably benign
R4097:Stil UTSW 4 115023600 missense probably benign 0.04
R4330:Stil UTSW 4 115004979 missense probably damaging 1.00
R4665:Stil UTSW 4 115041644 missense probably benign 0.00
R4688:Stil UTSW 4 115041308 missense probably damaging 1.00
R4740:Stil UTSW 4 115006782 missense probably benign 0.15
R4860:Stil UTSW 4 115038474 missense probably benign 0.01
R4860:Stil UTSW 4 115038474 missense probably benign 0.01
R4909:Stil UTSW 4 115024225 nonsense probably null
R6130:Stil UTSW 4 115029861 splice site probably null
R6523:Stil UTSW 4 115032714 frame shift probably null
R7294:Stil UTSW 4 115007283 missense probably benign 0.17
Z1088:Stil UTSW 4 115006693 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTAGGACATCCAAGTTGG -3'
(R):5'- CCTTAAAGCTTAGACGAATGGATC -3'

Sequencing Primer
(F):5'- CCAAGTTGGAAATTTATGTTGGAGC -3'
(R):5'- GACGAATGGATCTTTTACTTACCC -3'
Posted On2015-07-07