Incidental Mutation 'R2875:Zeb1'
ID 260532
Institutional Source Beutler Lab
Gene Symbol Zeb1
Ensembl Gene ENSMUSG00000024238
Gene Name zinc finger E-box binding homeobox 1
Synonyms Nil2, Tcf18, 3110032K11Rik, Zfhep, ZEB, AREB6, Tcf8, Zfhx1a, MEB1, Tw, [delta]EF1, Zfx1a
MMRRC Submission 040463-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R2875 (G1)
Quality Score 217
Status Not validated
Chromosome 18
Chromosomal Location 5591860-5775467 bp(+) (GRCm39)
Type of Mutation small insertion (1 aa in frame mutation)
DNA Base Change (assembly) GGA to GGAAGA at 5772859 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025081]
AlphaFold Q64318
Predicted Effect probably benign
Transcript: ENSMUST00000025081
SMART Domains Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
ZnF_C2H2 150 173 3.16e-3 SMART
ZnF_C2H2 180 202 3.21e-4 SMART
ZnF_C2H2 220 242 4.87e-4 SMART
ZnF_C2H2 248 268 1.86e1 SMART
low complexity region 288 304 N/A INTRINSIC
low complexity region 532 555 N/A INTRINSIC
HOX 559 621 7.53e-3 SMART
low complexity region 730 742 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
ZnF_C2H2 882 904 1.18e-2 SMART
ZnF_C2H2 910 932 4.4e-2 SMART
ZnF_C2H2 938 959 1.89e-1 SMART
coiled coil region 1006 1077 N/A INTRINSIC
low complexity region 1096 1112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177030
SMART Domains Protein: ENSMUSP00000135865
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 22 44 4.87e-4 SMART
low complexity region 277 300 N/A INTRINSIC
HOX 304 366 7.53e-3 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
ZnF_C2H2 627 649 1.18e-2 SMART
ZnF_C2H2 655 677 4.4e-2 SMART
ZnF_C2H2 683 704 1.89e-1 SMART
low complexity region 758 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (1/1)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations result in eye anomalies and extensive skeletal abnormalities. Homozygotes generally die at birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34l T A 8: 44,080,177 (GRCm39) K16* probably null Het
Adgb T G 10: 10,298,463 (GRCm39) T422P probably damaging Het
Adrm1 A G 2: 179,817,411 (GRCm39) T293A probably damaging Het
Baz1a A T 12: 54,969,904 (GRCm39) D585E probably damaging Het
Ccdc152 T C 15: 3,327,663 (GRCm39) N38S probably damaging Het
Cenpf A G 1: 189,390,841 (GRCm39) M997T probably benign Het
Dnah12 A G 14: 26,414,625 (GRCm39) I9V probably benign Het
Dnah12 A G 14: 26,598,907 (GRCm39) N995S probably benign Het
Dnah9 C A 11: 66,059,287 (GRCm39) G3C possibly damaging Het
Dock2 A G 11: 34,609,712 (GRCm39) S243P probably damaging Het
Eif2ak3 T C 6: 70,860,623 (GRCm39) S400P probably damaging Het
Eno1b A G 18: 48,180,851 (GRCm39) K343R possibly damaging Het
Grk6 A G 13: 55,600,117 (GRCm39) H271R probably damaging Het
H2-Ab1 A C 17: 34,482,286 (GRCm39) M1L probably benign Het
Irf8 C A 8: 121,481,202 (GRCm39) P262Q probably damaging Het
Kcnc3 G T 7: 44,240,961 (GRCm39) G218* probably null Het
Krt9 C A 11: 100,080,031 (GRCm39) G454* probably null Het
Mgrn1 C T 16: 4,725,280 (GRCm39) T47I possibly damaging Het
Ndst1 A T 18: 60,823,119 (GRCm39) F816I probably damaging Het
Or11g26 T A 14: 50,753,269 (GRCm39) W203R probably benign Het
Or5h25 A T 16: 58,930,165 (GRCm39) D269E probably benign Het
Phf12 C A 11: 77,900,573 (GRCm39) T223N probably damaging Het
Rad1 T C 15: 10,490,417 (GRCm39) V128A probably benign Het
Rad54l C T 4: 115,959,050 (GRCm39) R382Q probably benign Het
Rhbdd1 A G 1: 82,346,090 (GRCm39) D215G probably benign Het
Sdc4 T C 2: 164,273,211 (GRCm39) D33G possibly damaging Het
Smarca4 A T 9: 21,553,876 (GRCm39) K387N possibly damaging Het
St3gal5 A G 6: 72,124,114 (GRCm39) M214V possibly damaging Het
Stk25 T C 1: 93,556,973 (GRCm39) D15G possibly damaging Het
Timm21 T C 18: 84,969,217 (GRCm39) D69G probably benign Het
Ttll4 A G 1: 74,725,597 (GRCm39) probably null Het
Ttn T A 2: 76,589,438 (GRCm39) N21272I probably damaging Het
Uchl3 A G 14: 101,905,996 (GRCm39) H153R probably benign Het
Zbed6 C T 1: 133,584,598 (GRCm39) C913Y probably damaging Het
Zcwpw1 T C 5: 137,808,304 (GRCm39) S251P probably damaging Het
Zscan29 T C 2: 120,994,581 (GRCm39) Y468C probably damaging Het
Other mutations in Zeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zeb1 APN 18 5,767,774 (GRCm39) missense probably benign 0.00
IGL01139:Zeb1 APN 18 5,705,061 (GRCm39) missense possibly damaging 0.69
IGL01444:Zeb1 APN 18 5,767,138 (GRCm39) missense probably benign
IGL01444:Zeb1 APN 18 5,767,906 (GRCm39) missense probably damaging 1.00
IGL01806:Zeb1 APN 18 5,767,867 (GRCm39) missense possibly damaging 0.94
IGL01988:Zeb1 APN 18 5,759,037 (GRCm39) nonsense probably null
IGL02059:Zeb1 APN 18 5,766,892 (GRCm39) missense probably damaging 1.00
IGL03005:Zeb1 APN 18 5,767,150 (GRCm39) missense probably benign 0.03
IGL03153:Zeb1 APN 18 5,770,511 (GRCm39) missense probably damaging 1.00
Apes UTSW 18 5,761,394 (GRCm39) missense probably damaging 1.00
cellophane UTSW 18 5,770,554 (GRCm39) nonsense probably null
serpens UTSW 18 5,772,455 (GRCm39) missense probably damaging 1.00
N/A - 293:Zeb1 UTSW 18 5,767,076 (GRCm39) missense possibly damaging 0.68
R0184:Zeb1 UTSW 18 5,766,808 (GRCm39) missense probably damaging 1.00
R0488:Zeb1 UTSW 18 5,772,455 (GRCm39) missense probably damaging 1.00
R0622:Zeb1 UTSW 18 5,759,123 (GRCm39) nonsense probably null
R0646:Zeb1 UTSW 18 5,759,027 (GRCm39) missense probably damaging 1.00
R0881:Zeb1 UTSW 18 5,767,138 (GRCm39) missense probably benign
R1251:Zeb1 UTSW 18 5,705,089 (GRCm39) missense probably damaging 1.00
R1257:Zeb1 UTSW 18 5,772,699 (GRCm39) missense possibly damaging 0.53
R1501:Zeb1 UTSW 18 5,761,399 (GRCm39) missense possibly damaging 0.95
R1547:Zeb1 UTSW 18 5,767,450 (GRCm39) missense possibly damaging 0.50
R1797:Zeb1 UTSW 18 5,766,298 (GRCm39) nonsense probably null
R1815:Zeb1 UTSW 18 5,767,898 (GRCm39) missense probably damaging 1.00
R2090:Zeb1 UTSW 18 5,766,458 (GRCm39) missense possibly damaging 0.65
R2129:Zeb1 UTSW 18 5,767,681 (GRCm39) missense possibly damaging 0.92
R3888:Zeb1 UTSW 18 5,748,743 (GRCm39) missense probably damaging 1.00
R3941:Zeb1 UTSW 18 5,767,799 (GRCm39) missense probably benign 0.06
R3952:Zeb1 UTSW 18 5,772,716 (GRCm39) missense probably benign 0.17
R4271:Zeb1 UTSW 18 5,758,985 (GRCm39) missense probably damaging 0.99
R4512:Zeb1 UTSW 18 5,759,007 (GRCm39) missense probably damaging 1.00
R4514:Zeb1 UTSW 18 5,759,007 (GRCm39) missense probably damaging 1.00
R4677:Zeb1 UTSW 18 5,766,775 (GRCm39) missense probably damaging 0.97
R4729:Zeb1 UTSW 18 5,767,286 (GRCm39) missense probably damaging 1.00
R5839:Zeb1 UTSW 18 5,767,507 (GRCm39) missense probably benign
R5913:Zeb1 UTSW 18 5,766,765 (GRCm39) missense possibly damaging 0.49
R6248:Zeb1 UTSW 18 5,766,962 (GRCm39) missense probably damaging 1.00
R6354:Zeb1 UTSW 18 5,772,743 (GRCm39) missense possibly damaging 0.64
R6429:Zeb1 UTSW 18 5,770,498 (GRCm39) missense probably damaging 1.00
R6819:Zeb1 UTSW 18 5,591,917 (GRCm39) missense probably damaging 1.00
R7180:Zeb1 UTSW 18 5,767,867 (GRCm39) missense possibly damaging 0.94
R7193:Zeb1 UTSW 18 5,772,756 (GRCm39) missense probably damaging 0.98
R7199:Zeb1 UTSW 18 5,767,703 (GRCm39) missense probably benign 0.00
R7397:Zeb1 UTSW 18 5,761,394 (GRCm39) missense probably damaging 1.00
R7534:Zeb1 UTSW 18 5,766,611 (GRCm39) missense probably damaging 1.00
R7702:Zeb1 UTSW 18 5,766,802 (GRCm39) missense probably damaging 1.00
R7703:Zeb1 UTSW 18 5,766,917 (GRCm39) missense probably benign
R7934:Zeb1 UTSW 18 5,748,703 (GRCm39) missense probably benign 0.00
R8504:Zeb1 UTSW 18 5,705,127 (GRCm39) missense possibly damaging 0.94
R8539:Zeb1 UTSW 18 5,748,784 (GRCm39) missense probably damaging 0.99
R8716:Zeb1 UTSW 18 5,767,958 (GRCm39) missense probably damaging 0.99
R8772:Zeb1 UTSW 18 5,770,382 (GRCm39) critical splice acceptor site probably null
R8824:Zeb1 UTSW 18 5,748,680 (GRCm39) splice site probably benign
R9082:Zeb1 UTSW 18 5,772,557 (GRCm39) missense probably damaging 0.98
R9085:Zeb1 UTSW 18 5,766,716 (GRCm39) missense probably damaging 1.00
R9456:Zeb1 UTSW 18 5,766,709 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTCCTACTGCAAGAGAGGAG -3'
(R):5'- TCAGACAGCTGCTCACTCTC -3'

Sequencing Primer
(F):5'- CCTGGCGACTGAGCATGTTG -3'
(R):5'- AGCTGCTCACTCTCGCTTTCG -3'
Posted On 2015-01-23