Mutagenetix > Incidental Mutation

Incidental Mutation 'R2761:Hdac3'

254071

Institutional Source

Beutler Lab

Gene Symbol

Hdac3

Ensembl Gene

ENSMUSG00000024454

Gene Name

histone deacetylase 3

Synonyms

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2761 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

38070024-38088073 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 38078779 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 111 (S111T)

Ref Sequence

ENSEMBL: ENSMUSP00000037981 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043498]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000043498
AA Change: S111T

PolyPhen 2 Score 0.191 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000037981
Gene: ENSMUSG00000024454
AA Change: S111T

Domain	Start	End	E-Value	Type
Pfam:Hist_deacetyl	11	315	1.2e-82	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143660

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144471

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153945

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to the histone deacetylase/acuc/apha family. It has histone deacetylase activity and represses transcription when tethered to a promoter. It may participate in the regulation of transcription through its binding with the zinc-finger transcription factor YY1. This protein can also down-regulate p53 function and thus modulate cell growth and apoptosis. This gene is regarded as a potential tumor suppressor gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Disruption of this gene results in embryonic death at or around the time of gastrulation. Structural and functional abnormalities are also reported in mitochondria. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 137,773,541 (GRCm39)	V910A	probably damaging	Het
1700123K08Rik	T	C	5: 138,562,436 (GRCm39)	T102A	possibly damaging	Het
Acoxl	T	C	2: 127,719,733 (GRCm39)	Y165H	probably benign	Het
Alg11	C	A	8: 22,558,095 (GRCm39)	A469E	probably benign	Het
Cdh1	T	A	8: 107,380,481 (GRCm39)	I208N	possibly damaging	Het
Col11a2	A	G	17: 34,270,000 (GRCm39)	I477V	probably damaging	Het
Cpa2	A	G	6: 30,554,193 (GRCm39)	D271G	probably damaging	Het
Dzank1	T	C	2: 144,355,369 (GRCm39)	M109V	probably benign	Het
Kremen1	GGG	GGGTGG	11: 5,151,792 (GRCm39)		probably benign	Het
Krt31	T	C	11: 99,938,691 (GRCm39)	T301A	probably benign	Het
Rad21	T	A	15: 51,846,039 (GRCm39)	K10N	probably damaging	Het
Snap47	T	C	11: 59,328,885 (GRCm39)	D139G	probably benign	Het
Tango6	C	A	8: 107,425,664 (GRCm39)	T408N	possibly damaging	Het

Other mutations in Hdac3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00509:Hdac3	APN	18	38,087,938 (GRCm39)	missense	possibly damaging	0.95
IGL00570:Hdac3	APN	18	38,077,174 (GRCm39)	splice site	probably benign
IGL01511:Hdac3	APN	18	38,085,648 (GRCm39)	missense	probably benign	0.16
IGL01559:Hdac3	APN	18	38,076,725 (GRCm39)	splice site	probably benign
IGL01688:Hdac3	APN	18	38,087,932 (GRCm39)	missense	possibly damaging	0.53
IGL02529:Hdac3	APN	18	38,077,185 (GRCm39)	missense	probably benign	0.20
IGL02559:Hdac3	APN	18	38,087,944 (GRCm39)	missense	probably damaging	1.00
IGL02702:Hdac3	APN	18	38,074,147 (GRCm39)	missense	probably benign	0.00
PIT4520001:Hdac3	UTSW	18	38,074,817 (GRCm39)	missense	probably damaging	1.00
R0173:Hdac3	UTSW	18	38,074,806 (GRCm39)	missense	probably damaging	0.97
R0325:Hdac3	UTSW	18	38,074,005 (GRCm39)	critical splice donor site	probably null
R0445:Hdac3	UTSW	18	38,076,777 (GRCm39)	missense	probably damaging	0.99
R1341:Hdac3	UTSW	18	38,087,766 (GRCm39)	missense	probably damaging	1.00
R2068:Hdac3	UTSW	18	38,076,569 (GRCm39)	missense	probably damaging	1.00
R3805:Hdac3	UTSW	18	38,078,745 (GRCm39)	critical splice donor site	probably null
R4467:Hdac3	UTSW	18	38,085,566 (GRCm39)	missense	probably benign	0.03
R5928:Hdac3	UTSW	18	38,074,394 (GRCm39)	intron	probably benign
R5929:Hdac3	UTSW	18	38,074,394 (GRCm39)	intron	probably benign
R6341:Hdac3	UTSW	18	38,077,217 (GRCm39)	missense	probably damaging	0.99
R6679:Hdac3	UTSW	18	38,077,986 (GRCm39)	missense	possibly damaging	0.59
R6843:Hdac3	UTSW	18	38,075,007 (GRCm39)	missense	probably benign
R7262:Hdac3	UTSW	18	38,078,616 (GRCm39)	missense	probably damaging	0.99
R7559:Hdac3	UTSW	18	38,078,569 (GRCm39)	missense	possibly damaging	0.94
R7585:Hdac3	UTSW	18	38,078,408 (GRCm39)	missense	probably damaging	1.00
R7652:Hdac3	UTSW	18	38,087,972 (GRCm39)	unclassified	probably benign
R8434:Hdac3	UTSW	18	38,074,475 (GRCm39)	missense	possibly damaging	0.68
R9400:Hdac3	UTSW	18	38,070,677 (GRCm39)	missense	possibly damaging	0.71
Z1177:Hdac3	UTSW	18	38,078,804 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- ACAGTTTTCCCCATTGCAAC -3'
(R):5'- CTGTGAATGGCTCAGGTCTG -3'

Sequencing Primer
(F):5'- TTGGCATGATGTAGACCACC -3'
(R):5'- TGGCTCAGGTCTGGAGAAG -3'

Posted On

2014-12-04