Incidental Mutation 'R2395:Kmt2c'
ID 248485
Institutional Source Beutler Lab
Gene Symbol Kmt2c
Ensembl Gene ENSMUSG00000038056
Gene Name lysine (K)-specific methyltransferase 2C
Synonyms Mll3, HALR, E330008K23Rik
MMRRC Submission 040363-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2395 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 25476796-25703781 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 25520150 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1987 (I1987V)
Ref Sequence ENSEMBL: ENSMUSP00000043874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045291] [ENSMUST00000173073]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000045291
AA Change: I1987V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000043874
Gene: ENSMUSG00000038056
AA Change: I1987V

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 898 910 1.41e2 SMART
PHD 953 1002 2.89e-10 SMART
RING 954 1001 4.74e0 SMART
C1 994 1045 8.38e-2 SMART
PHD 1003 1049 1.05e-12 SMART
PHD 1080 1131 2.08e-2 SMART
low complexity region 1189 1201 N/A INTRINSIC
low complexity region 1337 1348 N/A INTRINSIC
low complexity region 1394 1406 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
low complexity region 1520 1539 N/A INTRINSIC
low complexity region 1557 1570 N/A INTRINSIC
HMG 1639 1703 2.64e-3 SMART
low complexity region 1708 1724 N/A INTRINSIC
coiled coil region 1745 1789 N/A INTRINSIC
low complexity region 1847 1860 N/A INTRINSIC
low complexity region 1864 1891 N/A INTRINSIC
internal_repeat_3 1893 2084 1.27e-14 PROSPERO
internal_repeat_3 2123 2306 1.27e-14 PROSPERO
low complexity region 2336 2348 N/A INTRINSIC
low complexity region 2375 2394 N/A INTRINSIC
low complexity region 2427 2440 N/A INTRINSIC
low complexity region 2516 2527 N/A INTRINSIC
low complexity region 2696 2720 N/A INTRINSIC
low complexity region 2723 2742 N/A INTRINSIC
low complexity region 2930 2943 N/A INTRINSIC
coiled coil region 3048 3075 N/A INTRINSIC
low complexity region 3156 3165 N/A INTRINSIC
low complexity region 3173 3195 N/A INTRINSIC
coiled coil region 3226 3270 N/A INTRINSIC
low complexity region 3277 3290 N/A INTRINSIC
coiled coil region 3389 3427 N/A INTRINSIC
low complexity region 3460 3486 N/A INTRINSIC
low complexity region 3597 3611 N/A INTRINSIC
low complexity region 3649 3667 N/A INTRINSIC
low complexity region 3769 3783 N/A INTRINSIC
low complexity region 3822 3827 N/A INTRINSIC
low complexity region 3860 3869 N/A INTRINSIC
low complexity region 3887 3904 N/A INTRINSIC
low complexity region 3994 4009 N/A INTRINSIC
low complexity region 4015 4038 N/A INTRINSIC
low complexity region 4293 4309 N/A INTRINSIC
low complexity region 4412 4419 N/A INTRINSIC
PHD 4454 4500 2.94e-2 SMART
RING 4455 4499 8.1e0 SMART
FYRN 4554 4597 1.18e-21 SMART
FYRC 4603 4690 4.54e-32 SMART
SET 4764 4886 3.17e-34 SMART
PostSET 4888 4904 1.82e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173073
SMART Domains Protein: ENSMUSP00000134442
Gene: ENSMUSG00000038056

DomainStartEndE-ValueType
low complexity region 9 32 N/A INTRINSIC
AT_hook 34 46 9.68e-1 SMART
low complexity region 73 87 N/A INTRINSIC
PHD 283 330 2.56e-2 SMART
C1 329 384 5.45e-1 SMART
PHD 342 388 4.19e-7 SMART
RING 343 387 1.45e-1 SMART
PHD 389 435 4.77e-11 SMART
RING 390 434 1.46e0 SMART
PHD 465 517 8.25e-6 SMART
low complexity region 776 789 N/A INTRINSIC
AT_hook 858 870 1.41e2 SMART
PHD 913 962 2.89e-10 SMART
RING 914 961 4.74e0 SMART
C1 954 1005 8.38e-2 SMART
PHD 963 1009 1.05e-12 SMART
PHD 1040 1091 2.08e-2 SMART
low complexity region 1149 1161 N/A INTRINSIC
low complexity region 1297 1308 N/A INTRINSIC
low complexity region 1354 1366 N/A INTRINSIC
low complexity region 1445 1464 N/A INTRINSIC
low complexity region 1482 1495 N/A INTRINSIC
HMG 1564 1628 2.64e-3 SMART
low complexity region 1633 1649 N/A INTRINSIC
coiled coil region 1670 1714 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (30/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the myeloid/lymphoid or mixed-lineage leukemia (MLL) family and encodes a nuclear protein with an AT hook DNA-binding domain, a DHHC-type zinc finger, six PHD-type zinc fingers, a SET domain, a post-SET domain and a RING-type zinc finger. This protein is a member of the ASC-2/NCOA6 complex (ASCOM), which possesses histone methylation activity and is involved in transcriptional coactivation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display partial embryonic lethality, delayed eyelid opening, postnatal growth retardation, impaired fertility in both sexes, and decreased proliferation of cultured mouse embryonic fibroblasts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A G 11: 109,959,614 (GRCm39) Y707H probably damaging Het
Abcc3 A G 11: 94,248,132 (GRCm39) V1156A possibly damaging Het
Acsl3 T C 1: 78,683,085 (GRCm39) V661A probably benign Het
Atosb C A 4: 43,035,964 (GRCm39) E256* probably null Het
B3glct A G 5: 149,677,651 (GRCm39) T427A probably damaging Het
Cblc C A 7: 19,519,305 (GRCm39) C341F probably damaging Het
Cntn2 T C 1: 132,454,110 (GRCm39) S299G probably benign Het
Dcp1b T C 6: 119,192,025 (GRCm39) S314P probably benign Het
Dnah6 T C 6: 73,068,950 (GRCm39) probably null Het
Fmn1 A G 2: 113,195,526 (GRCm39) T409A unknown Het
Hltf C T 3: 20,146,906 (GRCm39) A555V probably benign Het
Map3k10 T C 7: 27,373,418 (GRCm39) E11G unknown Het
Micu1 G T 10: 59,699,024 (GRCm39) E434* probably null Het
Mlph A G 1: 90,861,228 (GRCm39) T288A probably benign Het
Myh13 A G 11: 67,255,748 (GRCm39) E1679G probably benign Het
Myh15 A G 16: 48,889,877 (GRCm39) N156S probably benign Het
Nab1 A G 1: 52,529,741 (GRCm39) I52T probably damaging Het
Naip1 T C 13: 100,559,614 (GRCm39) H1130R possibly damaging Het
Or10al2 T G 17: 37,983,587 (GRCm39) Y224* probably null Het
Or8k23 A G 2: 86,186,609 (GRCm39) V39A probably benign Het
P2rx2 A G 5: 110,489,527 (GRCm39) Y136H probably damaging Het
Phf8-ps T C 17: 33,284,936 (GRCm39) E622G probably benign Het
Prss40 A G 1: 34,598,986 (GRCm39) V59A possibly damaging Het
Riox1 A T 12: 83,997,418 (GRCm39) probably null Het
Rxrb T G 17: 34,256,412 (GRCm39) C384W probably damaging Het
Srebf2 C T 15: 82,076,456 (GRCm39) T702I probably benign Het
Tmprss5 T A 9: 49,026,435 (GRCm39) L373* probably null Het
Trpm2 A C 10: 77,783,714 (GRCm39) I253S possibly damaging Het
Ush2a C T 1: 188,679,237 (GRCm39) T4815I probably damaging Het
Vmn2r73 A T 7: 85,506,975 (GRCm39) M779K probably damaging Het
Other mutations in Kmt2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00436:Kmt2c APN 5 25,486,259 (GRCm39) missense probably damaging 0.99
IGL00694:Kmt2c APN 5 25,498,159 (GRCm39) missense probably damaging 0.99
IGL00780:Kmt2c APN 5 25,516,049 (GRCm39) missense probably benign 0.00
IGL00811:Kmt2c APN 5 25,579,531 (GRCm39) missense possibly damaging 0.75
IGL00885:Kmt2c APN 5 25,614,169 (GRCm39) missense possibly damaging 0.80
IGL00948:Kmt2c APN 5 25,582,159 (GRCm39) missense probably benign 0.08
IGL00959:Kmt2c APN 5 25,481,227 (GRCm39) missense probably damaging 1.00
IGL01022:Kmt2c APN 5 25,507,699 (GRCm39) unclassified probably benign
IGL01146:Kmt2c APN 5 25,513,510 (GRCm39) missense probably damaging 0.96
IGL01154:Kmt2c APN 5 25,489,397 (GRCm39) missense probably damaging 1.00
IGL01434:Kmt2c APN 5 25,614,306 (GRCm39) missense probably damaging 1.00
IGL01464:Kmt2c APN 5 25,557,242 (GRCm39) missense possibly damaging 0.90
IGL01525:Kmt2c APN 5 25,534,439 (GRCm39) splice site probably benign
IGL01530:Kmt2c APN 5 25,518,498 (GRCm39) missense probably benign 0.08
IGL01550:Kmt2c APN 5 25,486,274 (GRCm39) missense probably damaging 1.00
IGL01598:Kmt2c APN 5 25,478,664 (GRCm39) makesense probably null
IGL01598:Kmt2c APN 5 25,559,769 (GRCm39) missense probably damaging 1.00
IGL01608:Kmt2c APN 5 25,559,809 (GRCm39) missense probably damaging 0.97
IGL01663:Kmt2c APN 5 25,515,668 (GRCm39) missense probably damaging 1.00
IGL01707:Kmt2c APN 5 25,505,096 (GRCm39) missense probably damaging 1.00
IGL01714:Kmt2c APN 5 25,518,398 (GRCm39) missense probably benign
IGL01784:Kmt2c APN 5 25,518,524 (GRCm39) missense probably damaging 1.00
IGL01813:Kmt2c APN 5 25,495,802 (GRCm39) missense possibly damaging 0.82
IGL01825:Kmt2c APN 5 25,515,594 (GRCm39) missense probably damaging 1.00
IGL01834:Kmt2c APN 5 25,600,453 (GRCm39) missense probably benign 0.05
IGL02072:Kmt2c APN 5 25,610,430 (GRCm39) missense possibly damaging 0.96
IGL02159:Kmt2c APN 5 25,516,341 (GRCm39) missense probably benign 0.18
IGL02303:Kmt2c APN 5 25,515,155 (GRCm39) missense probably damaging 0.96
IGL02417:Kmt2c APN 5 25,578,018 (GRCm39) missense probably benign
IGL02578:Kmt2c APN 5 25,571,198 (GRCm39) intron probably benign
IGL02811:Kmt2c APN 5 25,520,026 (GRCm39) nonsense probably null
IGL02943:Kmt2c APN 5 25,495,821 (GRCm39) missense probably damaging 1.00
IGL03000:Kmt2c APN 5 25,489,170 (GRCm39) missense probably damaging 1.00
IGL03040:Kmt2c APN 5 25,515,350 (GRCm39) missense probably benign
IGL03076:Kmt2c APN 5 25,504,149 (GRCm39) nonsense probably null
IGL03088:Kmt2c APN 5 25,504,802 (GRCm39) missense probably damaging 0.99
IGL03131:Kmt2c APN 5 25,520,359 (GRCm39) missense probably benign 0.00
FR4304:Kmt2c UTSW 5 25,520,764 (GRCm39) small insertion probably benign
FR4976:Kmt2c UTSW 5 25,520,761 (GRCm39) small insertion probably benign
PIT4520001:Kmt2c UTSW 5 25,520,664 (GRCm39) missense probably benign 0.12
PIT4585001:Kmt2c UTSW 5 25,520,104 (GRCm39) missense probably benign 0.21
R0313:Kmt2c UTSW 5 25,549,928 (GRCm39) missense probably damaging 1.00
R0374:Kmt2c UTSW 5 25,514,706 (GRCm39) missense probably damaging 1.00
R0411:Kmt2c UTSW 5 25,580,955 (GRCm39) missense probably damaging 1.00
R0422:Kmt2c UTSW 5 25,520,662 (GRCm39) missense probably benign
R0453:Kmt2c UTSW 5 25,559,745 (GRCm39) missense probably damaging 1.00
R0616:Kmt2c UTSW 5 25,504,250 (GRCm39) missense probably benign
R0619:Kmt2c UTSW 5 25,503,914 (GRCm39) missense probably benign 0.21
R0671:Kmt2c UTSW 5 25,609,363 (GRCm39) missense probably damaging 1.00
R0736:Kmt2c UTSW 5 25,500,432 (GRCm39) missense probably benign
R0745:Kmt2c UTSW 5 25,564,696 (GRCm39) splice site probably null
R0760:Kmt2c UTSW 5 25,558,315 (GRCm39) missense possibly damaging 0.68
R0784:Kmt2c UTSW 5 25,515,893 (GRCm39) missense probably benign 0.00
R0882:Kmt2c UTSW 5 25,500,605 (GRCm39) missense possibly damaging 0.90
R0893:Kmt2c UTSW 5 25,556,268 (GRCm39) splice site probably benign
R0942:Kmt2c UTSW 5 25,520,301 (GRCm39) missense probably benign 0.10
R1110:Kmt2c UTSW 5 25,519,360 (GRCm39) missense probably benign 0.01
R1137:Kmt2c UTSW 5 25,515,981 (GRCm39) missense possibly damaging 0.80
R1255:Kmt2c UTSW 5 25,556,151 (GRCm39) missense probably damaging 1.00
R1300:Kmt2c UTSW 5 25,610,452 (GRCm39) missense probably damaging 0.99
R1497:Kmt2c UTSW 5 25,519,513 (GRCm39) missense possibly damaging 0.80
R1594:Kmt2c UTSW 5 25,519,876 (GRCm39) missense probably benign 0.01
R1611:Kmt2c UTSW 5 25,564,309 (GRCm39) critical splice donor site probably null
R1617:Kmt2c UTSW 5 25,580,925 (GRCm39) missense probably benign 0.01
R1720:Kmt2c UTSW 5 25,504,182 (GRCm39) missense probably benign 0.05
R1723:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1724:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1726:Kmt2c UTSW 5 25,520,003 (GRCm39) missense probably damaging 1.00
R1736:Kmt2c UTSW 5 25,495,525 (GRCm39) missense probably damaging 1.00
R1778:Kmt2c UTSW 5 25,577,972 (GRCm39) missense probably benign 0.02
R1809:Kmt2c UTSW 5 25,489,190 (GRCm39) missense probably damaging 1.00
R1845:Kmt2c UTSW 5 25,578,434 (GRCm39) missense probably benign 0.45
R1895:Kmt2c UTSW 5 25,520,152 (GRCm39) missense probably benign 0.34
R1946:Kmt2c UTSW 5 25,520,152 (GRCm39) missense probably benign 0.34
R1989:Kmt2c UTSW 5 25,703,542 (GRCm39) missense possibly damaging 0.93
R2039:Kmt2c UTSW 5 25,534,038 (GRCm39) missense possibly damaging 0.53
R2049:Kmt2c UTSW 5 25,490,077 (GRCm39) missense probably damaging 1.00
R2079:Kmt2c UTSW 5 25,557,278 (GRCm39) missense possibly damaging 0.82
R2080:Kmt2c UTSW 5 25,559,715 (GRCm39) missense probably damaging 1.00
R2107:Kmt2c UTSW 5 25,514,822 (GRCm39) missense probably benign 0.01
R2186:Kmt2c UTSW 5 25,492,110 (GRCm39) missense probably damaging 1.00
R2983:Kmt2c UTSW 5 25,520,755 (GRCm39) small deletion probably benign
R3109:Kmt2c UTSW 5 25,480,733 (GRCm39) missense probably damaging 1.00
R3500:Kmt2c UTSW 5 25,504,477 (GRCm39) missense probably benign 0.02
R3738:Kmt2c UTSW 5 25,610,381 (GRCm39) missense probably benign 0.41
R3809:Kmt2c UTSW 5 25,614,136 (GRCm39) missense possibly damaging 0.87
R4088:Kmt2c UTSW 5 25,492,711 (GRCm39) missense probably benign
R4107:Kmt2c UTSW 5 25,503,918 (GRCm39) missense possibly damaging 0.51
R4212:Kmt2c UTSW 5 25,552,357 (GRCm39) critical splice donor site probably null
R4376:Kmt2c UTSW 5 25,520,324 (GRCm39) missense probably benign 0.00
R4377:Kmt2c UTSW 5 25,520,324 (GRCm39) missense probably benign 0.00
R4383:Kmt2c UTSW 5 25,556,060 (GRCm39) missense possibly damaging 0.77
R4435:Kmt2c UTSW 5 25,519,875 (GRCm39) missense possibly damaging 0.63
R4456:Kmt2c UTSW 5 25,515,210 (GRCm39) missense probably benign
R4461:Kmt2c UTSW 5 25,504,874 (GRCm39) missense probably benign 0.00
R4519:Kmt2c UTSW 5 25,568,475 (GRCm39) missense probably damaging 1.00
R4550:Kmt2c UTSW 5 25,505,172 (GRCm39) missense probably damaging 1.00
R4557:Kmt2c UTSW 5 25,505,313 (GRCm39) missense probably damaging 1.00
R4610:Kmt2c UTSW 5 25,559,382 (GRCm39) missense probably damaging 1.00
R4671:Kmt2c UTSW 5 25,571,175 (GRCm39) missense probably damaging 1.00
R4704:Kmt2c UTSW 5 25,519,025 (GRCm39) nonsense probably null
R4781:Kmt2c UTSW 5 25,648,823 (GRCm39) missense probably damaging 1.00
R4844:Kmt2c UTSW 5 25,520,111 (GRCm39) missense probably benign
R4855:Kmt2c UTSW 5 25,519,555 (GRCm39) missense probably benign 0.00
R4919:Kmt2c UTSW 5 25,519,393 (GRCm39) missense possibly damaging 0.80
R4971:Kmt2c UTSW 5 25,515,870 (GRCm39) missense probably benign 0.00
R4983:Kmt2c UTSW 5 25,500,509 (GRCm39) missense possibly damaging 0.51
R5012:Kmt2c UTSW 5 25,504,710 (GRCm39) nonsense probably null
R5033:Kmt2c UTSW 5 25,519,706 (GRCm39) missense probably benign 0.03
R5093:Kmt2c UTSW 5 25,614,205 (GRCm39) missense probably benign 0.17
R5125:Kmt2c UTSW 5 25,489,379 (GRCm39) missense probably damaging 0.99
R5231:Kmt2c UTSW 5 25,520,471 (GRCm39) missense possibly damaging 0.89
R5254:Kmt2c UTSW 5 25,519,592 (GRCm39) missense probably benign 0.01
R5396:Kmt2c UTSW 5 25,499,732 (GRCm39) splice site probably null
R5415:Kmt2c UTSW 5 25,519,699 (GRCm39) missense probably benign 0.21
R5523:Kmt2c UTSW 5 25,504,337 (GRCm39) missense probably benign 0.00
R5554:Kmt2c UTSW 5 25,499,608 (GRCm39) missense probably damaging 1.00
R5701:Kmt2c UTSW 5 25,519,015 (GRCm39) missense probably benign 0.16
R5762:Kmt2c UTSW 5 25,515,455 (GRCm39) missense probably benign 0.01
R5819:Kmt2c UTSW 5 25,614,130 (GRCm39) critical splice donor site probably null
R5838:Kmt2c UTSW 5 25,489,469 (GRCm39) missense probably damaging 1.00
R5912:Kmt2c UTSW 5 25,552,467 (GRCm39) missense possibly damaging 0.80
R5951:Kmt2c UTSW 5 25,535,801 (GRCm39) missense probably benign 0.15
R5988:Kmt2c UTSW 5 25,516,118 (GRCm39) missense probably benign 0.02
R5999:Kmt2c UTSW 5 25,489,203 (GRCm39) missense probably damaging 1.00
R6104:Kmt2c UTSW 5 25,504,127 (GRCm39) missense probably benign
R6254:Kmt2c UTSW 5 25,554,872 (GRCm39) missense possibly damaging 0.94
R6311:Kmt2c UTSW 5 25,648,816 (GRCm39) critical splice donor site probably null
R6329:Kmt2c UTSW 5 25,520,600 (GRCm39) missense probably benign 0.01
R6347:Kmt2c UTSW 5 25,515,833 (GRCm39) missense possibly damaging 0.54
R6364:Kmt2c UTSW 5 25,514,634 (GRCm39) missense probably null 0.99
R6379:Kmt2c UTSW 5 25,564,339 (GRCm39) missense probably damaging 1.00
R6588:Kmt2c UTSW 5 25,528,787 (GRCm39) missense probably damaging 0.99
R6628:Kmt2c UTSW 5 25,503,926 (GRCm39) missense probably benign
R6733:Kmt2c UTSW 5 25,614,291 (GRCm39) missense probably damaging 1.00
R6787:Kmt2c UTSW 5 25,480,737 (GRCm39) splice site probably null
R6816:Kmt2c UTSW 5 25,610,530 (GRCm39) splice site probably null
R6862:Kmt2c UTSW 5 25,515,515 (GRCm39) missense probably damaging 1.00
R7150:Kmt2c UTSW 5 25,505,360 (GRCm39) missense possibly damaging 0.89
R7220:Kmt2c UTSW 5 25,549,923 (GRCm39) missense probably damaging 1.00
R7250:Kmt2c UTSW 5 25,514,805 (GRCm39) missense probably benign 0.00
R7250:Kmt2c UTSW 5 25,504,489 (GRCm39) missense probably damaging 1.00
R7402:Kmt2c UTSW 5 25,600,418 (GRCm39) missense probably damaging 1.00
R7465:Kmt2c UTSW 5 25,507,847 (GRCm39) missense probably damaging 1.00
R7467:Kmt2c UTSW 5 25,513,530 (GRCm39) missense probably damaging 1.00
R7491:Kmt2c UTSW 5 25,489,562 (GRCm39) missense probably damaging 0.99
R7549:Kmt2c UTSW 5 25,619,968 (GRCm39) missense possibly damaging 0.95
R7637:Kmt2c UTSW 5 25,520,093 (GRCm39) missense probably damaging 1.00
R7652:Kmt2c UTSW 5 25,520,717 (GRCm39) missense probably benign 0.01
R7714:Kmt2c UTSW 5 25,580,364 (GRCm39) missense probably benign
R7838:Kmt2c UTSW 5 25,499,697 (GRCm39) missense possibly damaging 0.57
R7891:Kmt2c UTSW 5 25,505,109 (GRCm39) missense probably damaging 1.00
R7892:Kmt2c UTSW 5 25,504,814 (GRCm39) missense probably benign 0.18
R7895:Kmt2c UTSW 5 25,578,174 (GRCm39) missense possibly damaging 0.65
R7960:Kmt2c UTSW 5 25,520,194 (GRCm39) missense probably benign 0.01
R7974:Kmt2c UTSW 5 25,505,561 (GRCm39) missense probably damaging 1.00
R7978:Kmt2c UTSW 5 25,564,676 (GRCm39) missense probably benign 0.00
R8011:Kmt2c UTSW 5 25,556,232 (GRCm39) missense probably damaging 0.99
R8021:Kmt2c UTSW 5 25,492,117 (GRCm39) missense possibly damaging 0.88
R8022:Kmt2c UTSW 5 25,486,678 (GRCm39) missense possibly damaging 0.83
R8079:Kmt2c UTSW 5 25,507,730 (GRCm39) missense probably damaging 0.98
R8087:Kmt2c UTSW 5 25,534,250 (GRCm39) missense probably damaging 1.00
R8109:Kmt2c UTSW 5 25,486,382 (GRCm39) missense probably damaging 1.00
R8161:Kmt2c UTSW 5 25,579,562 (GRCm39) missense probably benign 0.00
R8169:Kmt2c UTSW 5 25,559,685 (GRCm39) missense probably damaging 1.00
R8206:Kmt2c UTSW 5 25,519,537 (GRCm39) missense probably damaging 0.98
R8218:Kmt2c UTSW 5 25,488,104 (GRCm39) missense probably damaging 1.00
R8223:Kmt2c UTSW 5 25,529,216 (GRCm39) missense possibly damaging 0.89
R8260:Kmt2c UTSW 5 25,610,514 (GRCm39) missense possibly damaging 0.87
R8330:Kmt2c UTSW 5 25,509,692 (GRCm39) missense probably null 1.00
R8355:Kmt2c UTSW 5 25,559,499 (GRCm39) critical splice acceptor site probably null
R8455:Kmt2c UTSW 5 25,559,499 (GRCm39) critical splice acceptor site probably null
R8508:Kmt2c UTSW 5 25,519,120 (GRCm39) missense probably benign 0.34
R8885:Kmt2c UTSW 5 25,520,077 (GRCm39) missense probably benign 0.34
R8907:Kmt2c UTSW 5 25,514,609 (GRCm39) missense probably damaging 1.00
R8924:Kmt2c UTSW 5 25,503,885 (GRCm39) missense probably benign
R8969:Kmt2c UTSW 5 25,519,387 (GRCm39) missense possibly damaging 0.82
R9019:Kmt2c UTSW 5 25,488,208 (GRCm39) missense probably damaging 1.00
R9035:Kmt2c UTSW 5 25,524,010 (GRCm39) missense probably damaging 1.00
R9074:Kmt2c UTSW 5 25,489,343 (GRCm39) missense probably damaging 1.00
R9125:Kmt2c UTSW 5 25,489,194 (GRCm39) missense possibly damaging 0.86
R9130:Kmt2c UTSW 5 25,516,102 (GRCm39) missense probably benign 0.01
R9171:Kmt2c UTSW 5 25,486,309 (GRCm39) missense probably damaging 1.00
R9235:Kmt2c UTSW 5 25,504,997 (GRCm39) missense probably damaging 1.00
R9288:Kmt2c UTSW 5 25,554,860 (GRCm39) missense probably benign 0.34
R9288:Kmt2c UTSW 5 25,497,907 (GRCm39) missense probably damaging 1.00
R9336:Kmt2c UTSW 5 25,614,165 (GRCm39) missense probably benign 0.06
R9443:Kmt2c UTSW 5 25,515,045 (GRCm39) missense probably damaging 1.00
R9481:Kmt2c UTSW 5 25,497,907 (GRCm39) missense probably damaging 1.00
R9481:Kmt2c UTSW 5 25,554,860 (GRCm39) missense probably benign 0.34
R9526:Kmt2c UTSW 5 25,486,355 (GRCm39) missense probably damaging 1.00
R9653:Kmt2c UTSW 5 25,507,819 (GRCm39) missense probably damaging 1.00
R9729:Kmt2c UTSW 5 25,489,758 (GRCm39) missense probably damaging 1.00
R9731:Kmt2c UTSW 5 25,577,956 (GRCm39) missense probably benign 0.18
R9784:Kmt2c UTSW 5 25,549,959 (GRCm39) missense probably damaging 1.00
RF001:Kmt2c UTSW 5 25,520,773 (GRCm39) small insertion probably benign
RF006:Kmt2c UTSW 5 25,520,770 (GRCm39) small insertion probably benign
RF011:Kmt2c UTSW 5 25,543,457 (GRCm39) missense probably damaging 1.00
RF041:Kmt2c UTSW 5 25,520,773 (GRCm39) small insertion probably benign
RF047:Kmt2c UTSW 5 25,520,758 (GRCm39) small insertion probably benign
RF051:Kmt2c UTSW 5 25,518,477 (GRCm39) unclassified probably benign
RF055:Kmt2c UTSW 5 25,520,770 (GRCm39) small insertion probably benign
RF059:Kmt2c UTSW 5 25,518,477 (GRCm39) unclassified probably benign
RF063:Kmt2c UTSW 5 25,520,762 (GRCm39) small insertion probably benign
X0024:Kmt2c UTSW 5 25,610,483 (GRCm39) missense probably benign 0.26
X0027:Kmt2c UTSW 5 25,535,885 (GRCm39) missense possibly damaging 0.90
Z1176:Kmt2c UTSW 5 25,559,411 (GRCm39) missense probably damaging 1.00
Z1177:Kmt2c UTSW 5 25,571,195 (GRCm39) critical splice acceptor site probably null
Z1177:Kmt2c UTSW 5 25,505,001 (GRCm39) missense probably benign 0.00
Z1177:Kmt2c UTSW 5 25,500,395 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGAGAGTCGTCTTGATGTCTG -3'
(R):5'- CAGTACCTAGGCCCATTCATATG -3'

Sequencing Primer
(F):5'- TCCATATGGATCCTGAGATGGAG -3'
(R):5'- TATGAATGAAACATCAGCCACAAGG -3'
Posted On 2014-11-11