Mutagenetix > Incidental Mutation

Incidental Mutation 'R2174:Trrap'

237686

Institutional Source

Beutler Lab

Gene Symbol

Trrap

Ensembl Gene

ENSMUSG00000045482

Gene Name

transformation/transcription domain-associated protein

Synonyms

transactivation/transformation-domain associated protein

MMRRC Submission

040176-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2174 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

144704547-144796588 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 144758665 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 2183 (P2183Q)

Ref Sequence

ENSEMBL: ENSMUSP00000148419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000038980
AA Change: P2164Q

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: P2164Q

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3363	3376	N/A	INTRINSIC
low complexity region	3407	3418	N/A	INTRINSIC
PI3Kc	3509	3798	5.11e-8	SMART
FATC	3797	3829	1.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000094120
AA Change: P2182Q

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: P2182Q

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1682	2e-6	SMART
low complexity region	1850	1861	N/A	INTRINSIC
low complexity region	1884	1899	N/A	INTRINSIC
low complexity region	2307	2321	N/A	INTRINSIC
Pfam:FAT	2848	3203	1.1e-68	PFAM
low complexity region	3392	3405	N/A	INTRINSIC
low complexity region	3436	3447	N/A	INTRINSIC
PI3Kc	3538	3827	5.11e-8	SMART
FATC	3826	3858	1.89e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000100467
AA Change: P2164Q

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: P2164Q

Domain	Start	End	E-Value	Type
low complexity region	482	527	N/A	INTRINSIC
low complexity region	529	540	N/A	INTRINSIC
Blast:PI3Kc	765	864	1e-13	BLAST
SCOP:d1gw5a_	1184	1664	2e-6	SMART
low complexity region	1832	1843	N/A	INTRINSIC
low complexity region	1866	1881	N/A	INTRINSIC
low complexity region	2289	2303	N/A	INTRINSIC
Pfam:FAT	2830	3174	4.7e-69	PFAM
low complexity region	3381	3394	N/A	INTRINSIC
low complexity region	3425	3436	N/A	INTRINSIC
PI3Kc	3527	3816	5.11e-8	SMART
FATC	3815	3847	1.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132347

Predicted Effect

unknown
Transcript: ENSMUST00000132925
AA Change: P1903Q

SMART Domains

Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: P1903Q

Domain	Start	End	E-Value	Type
low complexity region	197	242	N/A	INTRINSIC
low complexity region	244	255	N/A	INTRINSIC
SCOP:d1gw5a_	474	1003	9e-7	SMART
Blast:PI3Kc	480	579	1e-13	BLAST
low complexity region	1083	1092	N/A	INTRINSIC
low complexity region	1572	1583	N/A	INTRINSIC
low complexity region	1606	1621	N/A	INTRINSIC
low complexity region	2029	2043	N/A	INTRINSIC
Pfam:FAT	2570	2914	1.5e-69	PFAM
low complexity region	3121	3134	N/A	INTRINSIC
low complexity region	3165	3176	N/A	INTRINSIC
PI3Kc	3267	3556	5.11e-8	SMART
FATC	3555	3587	1.89e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143357

Predicted Effect

probably benign
Transcript: ENSMUST00000213013
AA Change: P2183Q

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)

Meta Mutation Damage Score

0.0681

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

99% (73/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1600014C10Rik	T	C	7: 37,894,252 (GRCm39)	I95T	possibly damaging	Het
Adarb1	A	G	10: 77,131,632 (GRCm39)	I619T	probably benign	Het
Aldh2	T	C	5: 121,710,731 (GRCm39)		probably benign	Het
Antxrl	T	A	14: 33,782,357 (GRCm39)	L180Q	probably damaging	Het
Asnsd1	A	T	1: 53,386,760 (GRCm39)	I289N	probably benign	Het
Asxl3	T	G	18: 22,586,701 (GRCm39)	S164A	possibly damaging	Het
Cacnb2	C	T	2: 14,963,578 (GRCm39)	T108I	probably benign	Het
Capn2	A	T	1: 182,307,290 (GRCm39)	I516N	probably benign	Het
Ccdc59	A	T	10: 105,677,388 (GRCm39)	K9M	possibly damaging	Het
Cenpo	T	C	12: 4,267,318 (GRCm39)	K73R	probably benign	Het
Cfap20dc	T	C	14: 8,558,109 (GRCm38)	I159V	probably benign	Het
Clasp1	A	G	1: 118,487,825 (GRCm39)	H823R	probably damaging	Het
Col6a4	T	C	9: 105,937,331 (GRCm39)	D1395G	probably damaging	Het
Ddx60	A	G	8: 62,409,175 (GRCm39)	I404V	probably damaging	Het
Ddx60	G	T	8: 62,470,234 (GRCm39)	M1407I	probably benign	Het
Dennd3	A	T	15: 73,427,154 (GRCm39)	R844W	probably damaging	Het
Depdc1b	A	T	13: 108,498,787 (GRCm39)	K157*	probably null	Het
Dnai7	T	C	6: 145,120,896 (GRCm39)	H641R	probably damaging	Het
Dnajc1	T	C	2: 18,312,762 (GRCm39)	D196G	probably damaging	Het
Fanca	A	G	8: 123,998,009 (GRCm39)	W1226R	probably benign	Het
Fbxl13	A	G	5: 21,787,046 (GRCm39)	V297A	possibly damaging	Het
Fnta	A	T	8: 26,503,498 (GRCm39)	F96I	possibly damaging	Het
Fzd3	T	C	14: 65,449,680 (GRCm39)		probably benign	Het
Gckr	T	C	5: 31,484,353 (GRCm39)	V597A	possibly damaging	Het
Gm43302	T	C	5: 105,422,216 (GRCm39)	K496R	probably benign	Het
Gm5283	A	G	3: 17,285,005 (GRCm39)		noncoding transcript	Het
Gm6741	A	G	17: 91,544,332 (GRCm39)	I32V	probably benign	Het
Gnptab	T	A	10: 88,269,906 (GRCm39)	F870I	probably damaging	Het
Gpx8	G	A	13: 113,182,140 (GRCm39)	P98S	probably benign	Het
Grm2	T	C	9: 106,524,994 (GRCm39)	I574V	probably benign	Het
Gtf3c5	T	C	2: 28,457,787 (GRCm39)	D468G	probably benign	Het
Hectd3	A	T	4: 116,856,898 (GRCm39)	M482L	probably benign	Het
Ier5	G	T	1: 154,974,599 (GRCm39)	P193H	possibly damaging	Het
Inpp4a	A	G	1: 37,435,211 (GRCm39)	N827S	probably damaging	Het
Kif13a	A	G	13: 46,922,652 (GRCm39)	L387P	probably damaging	Het
Map3k1	G	C	13: 111,889,016 (GRCm39)	H1314D	possibly damaging	Het
Mbl2	G	A	19: 30,211,412 (GRCm39)	C11Y	possibly damaging	Het
Msr1	A	G	8: 40,084,381 (GRCm39)	L58P	probably damaging	Het
Mtmr10	T	A	7: 63,986,512 (GRCm39)	F530Y	possibly damaging	Het
Myo7b	A	G	18: 32,116,610 (GRCm39)	L999P	probably damaging	Het
Myoz3	T	C	18: 60,723,296 (GRCm39)	E8G	probably benign	Het
Naip6	C	A	13: 100,435,495 (GRCm39)	M1009I	probably benign	Het
Nav2	T	A	7: 49,102,411 (GRCm39)	M342K	probably damaging	Het
Ndufaf6	T	C	4: 11,070,228 (GRCm39)	H131R	probably benign	Het
Nlrp4a	T	C	7: 26,148,849 (GRCm39)	L152P	probably damaging	Het
Or9s23	A	G	1: 92,501,379 (GRCm39)	N162S	probably benign	Het
Pan3	T	C	5: 147,387,463 (GRCm39)	I144T	possibly damaging	Het
Prkdc	A	T	16: 15,552,786 (GRCm39)	Q2074L	probably benign	Het
Pthlh	G	A	6: 147,158,510 (GRCm39)	T150I	probably benign	Het
Ptprq	A	T	10: 107,541,414 (GRCm39)	Y371N	probably damaging	Het
Rfwd3	A	G	8: 112,009,975 (GRCm39)	S377P	probably damaging	Het
Rpl31-ps17	C	T	12: 54,748,397 (GRCm39)		noncoding transcript	Het
Sap130	T	C	18: 31,810,532 (GRCm39)		probably null	Het
Sap25	T	G	5: 137,640,891 (GRCm39)	M229R	possibly damaging	Het
Scaper	A	T	9: 55,766,321 (GRCm39)	V479E	probably null	Het
Scn3a	T	A	2: 65,337,550 (GRCm39)	D649V	probably damaging	Het
Slco1a7	A	T	6: 141,673,319 (GRCm39)	Y406*	probably null	Het
Smc1b	A	G	15: 85,006,052 (GRCm39)		probably benign	Het
Sowahb	T	C	5: 93,192,284 (GRCm39)	E145G	possibly damaging	Het
Stxbp5	T	A	10: 9,711,590 (GRCm39)	I277F	possibly damaging	Het
Tanc1	T	C	2: 59,674,177 (GRCm39)	S1754P	possibly damaging	Het
Tanc2	A	G	11: 105,801,135 (GRCm39)	D1117G	probably benign	Het
Tbc1d31	A	G	15: 57,815,137 (GRCm39)	M605V	possibly damaging	Het
Tekt3	A	T	11: 62,985,514 (GRCm39)	D440V	possibly damaging	Het
Tmem67	C	T	4: 12,063,730 (GRCm39)	W477*	probably null	Het
Tra2a	T	C	6: 49,227,861 (GRCm39)		probably benign	Het
Trappc12	A	G	12: 28,797,380 (GRCm39)	F51L	possibly damaging	Het
Ubn2	T	A	6: 38,447,076 (GRCm39)		probably null	Het
Unc5d	A	T	8: 29,184,568 (GRCm39)	V644E	probably damaging	Het
Xpo4	A	G	14: 57,827,547 (GRCm39)	L883P	probably damaging	Het
Zbbx	T	G	3: 74,959,721 (GRCm39)	D616A	possibly damaging	Het
Zfp943	T	A	17: 22,211,804 (GRCm39)	C297S	probably damaging	Het

Other mutations in Trrap

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Trrap	APN	5	144,716,784 (GRCm39)	splice site	probably benign
IGL00470:Trrap	APN	5	144,754,848 (GRCm39)	missense	probably damaging	1.00
IGL00490:Trrap	APN	5	144,762,035 (GRCm39)	missense	probably benign	0.40
IGL01072:Trrap	APN	5	144,721,065 (GRCm39)	splice site	probably benign
IGL01087:Trrap	APN	5	144,783,349 (GRCm39)	missense	probably damaging	0.99
IGL01300:Trrap	APN	5	144,741,628 (GRCm39)	missense	probably damaging	1.00
IGL01350:Trrap	APN	5	144,767,779 (GRCm39)	missense	possibly damaging	0.92
IGL01410:Trrap	APN	5	144,767,831 (GRCm39)	missense	probably benign	0.00
IGL01571:Trrap	APN	5	144,770,097 (GRCm39)	splice site	probably benign
IGL01748:Trrap	APN	5	144,770,150 (GRCm39)	missense	probably damaging	1.00
IGL01839:Trrap	APN	5	144,758,685 (GRCm39)	missense	probably damaging	1.00
IGL01976:Trrap	APN	5	144,793,799 (GRCm39)	missense	probably benign	0.00
IGL02075:Trrap	APN	5	144,765,304 (GRCm39)	missense	probably benign	0.00
IGL02127:Trrap	APN	5	144,753,243 (GRCm39)	missense	probably benign	0.22
IGL02131:Trrap	APN	5	144,777,246 (GRCm39)	missense	probably damaging	1.00
IGL02287:Trrap	APN	5	144,769,348 (GRCm39)	missense	probably damaging	1.00
IGL02301:Trrap	APN	5	144,714,727 (GRCm39)	missense	probably benign	0.05
IGL02336:Trrap	APN	5	144,735,200 (GRCm39)	missense	probably benign	0.39
IGL02526:Trrap	APN	5	144,761,360 (GRCm39)	missense	probably benign	0.00
IGL02873:Trrap	APN	5	144,777,889 (GRCm39)	splice site	probably benign
IGL02953:Trrap	APN	5	144,752,774 (GRCm39)	missense	probably damaging	0.99
IGL03404:Trrap	APN	5	144,769,996 (GRCm39)	missense	probably benign	0.00
Buffer	UTSW	5	144,771,014 (GRCm39)	missense	probably benign	0.06
Card-tower	UTSW	5	144,741,576 (GRCm39)	missense	probably damaging	1.00
Cookie	UTSW	5	144,730,859 (GRCm39)	missense	probably damaging	1.00
Glass_house	UTSW	5	144,782,287 (GRCm39)	missense	possibly damaging	0.67
Immovable	UTSW	5	144,727,665 (GRCm39)	missense	possibly damaging	0.66
R5049_trrap_520	UTSW	5	144,763,527 (GRCm39)	missense	probably damaging	1.00
R7167_Trrap_977	UTSW	5	144,776,424 (GRCm39)	missense	probably benign	0.39
vitreous	UTSW	5	144,742,537 (GRCm39)	missense	probably damaging	1.00
PIT4243001:Trrap	UTSW	5	144,733,781 (GRCm39)	missense	probably benign	0.00
PIT4466001:Trrap	UTSW	5	144,765,410 (GRCm39)	missense	probably benign	0.02
R0062:Trrap	UTSW	5	144,719,003 (GRCm39)	splice site	probably benign
R0062:Trrap	UTSW	5	144,719,003 (GRCm39)	splice site	probably benign
R0112:Trrap	UTSW	5	144,759,571 (GRCm39)	nonsense	probably null
R0126:Trrap	UTSW	5	144,742,560 (GRCm39)	nonsense	probably null
R0257:Trrap	UTSW	5	144,741,045 (GRCm39)	missense	probably benign	0.31
R0325:Trrap	UTSW	5	144,753,205 (GRCm39)	missense	probably benign	0.05
R0376:Trrap	UTSW	5	144,753,149 (GRCm39)	missense	probably benign	0.03
R0396:Trrap	UTSW	5	144,751,366 (GRCm39)	missense	probably damaging	0.99
R0448:Trrap	UTSW	5	144,776,377 (GRCm39)	missense	possibly damaging	0.66
R0454:Trrap	UTSW	5	144,783,287 (GRCm39)	missense	probably damaging	1.00
R0711:Trrap	UTSW	5	144,790,309 (GRCm39)	missense	probably damaging	1.00
R0827:Trrap	UTSW	5	144,751,640 (GRCm39)	missense	probably benign	0.00
R1005:Trrap	UTSW	5	144,742,537 (GRCm39)	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144,741,576 (GRCm39)	missense	probably damaging	1.00
R1147:Trrap	UTSW	5	144,741,576 (GRCm39)	missense	probably damaging	1.00
R1179:Trrap	UTSW	5	144,714,749 (GRCm39)	missense	possibly damaging	0.94
R1218:Trrap	UTSW	5	144,753,219 (GRCm39)	missense	probably damaging	1.00
R1264:Trrap	UTSW	5	144,726,409 (GRCm39)	splice site	probably benign
R1374:Trrap	UTSW	5	144,783,428 (GRCm39)	missense	probably damaging	1.00
R1401:Trrap	UTSW	5	144,794,232 (GRCm39)	missense	possibly damaging	0.93
R1480:Trrap	UTSW	5	144,755,123 (GRCm39)	missense	probably benign
R1538:Trrap	UTSW	5	144,774,012 (GRCm39)	missense	possibly damaging	0.65
R1751:Trrap	UTSW	5	144,751,385 (GRCm39)	critical splice donor site	probably null
R1779:Trrap	UTSW	5	144,765,400 (GRCm39)	missense	probably benign	0.01
R1782:Trrap	UTSW	5	144,759,513 (GRCm39)	missense	possibly damaging	0.93
R1792:Trrap	UTSW	5	144,790,396 (GRCm39)	missense	possibly damaging	0.87
R1859:Trrap	UTSW	5	144,767,761 (GRCm39)	missense	probably benign	0.04
R1861:Trrap	UTSW	5	144,752,727 (GRCm39)	splice site	probably null
R1902:Trrap	UTSW	5	144,752,863 (GRCm39)	missense	probably damaging	1.00
R1903:Trrap	UTSW	5	144,752,863 (GRCm39)	missense	probably damaging	1.00
R2021:Trrap	UTSW	5	144,790,298 (GRCm39)	missense	possibly damaging	0.94
R2026:Trrap	UTSW	5	144,739,854 (GRCm39)	missense	possibly damaging	0.86
R2036:Trrap	UTSW	5	144,765,372 (GRCm39)	missense	probably benign	0.08
R2099:Trrap	UTSW	5	144,719,049 (GRCm39)	missense	possibly damaging	0.46
R2108:Trrap	UTSW	5	144,762,684 (GRCm39)	missense	probably benign	0.01
R2113:Trrap	UTSW	5	144,781,021 (GRCm39)	missense	probably damaging	1.00
R2442:Trrap	UTSW	5	144,754,776 (GRCm39)	missense	probably damaging	1.00
R2568:Trrap	UTSW	5	144,780,179 (GRCm39)	critical splice donor site	probably null
R3442:Trrap	UTSW	5	144,729,062 (GRCm39)	missense	probably benign	0.03
R3853:Trrap	UTSW	5	144,728,975 (GRCm39)	missense	probably damaging	1.00
R4401:Trrap	UTSW	5	144,780,128 (GRCm39)	missense	possibly damaging	0.60
R4493:Trrap	UTSW	5	144,767,858 (GRCm39)	missense	probably benign	0.21
R4524:Trrap	UTSW	5	144,762,131 (GRCm39)	missense	probably benign	0.38
R4569:Trrap	UTSW	5	144,728,928 (GRCm39)	missense	probably benign	0.13
R4672:Trrap	UTSW	5	144,722,290 (GRCm39)	missense	probably damaging	0.97
R4732:Trrap	UTSW	5	144,753,380 (GRCm39)	missense	probably damaging	1.00
R4733:Trrap	UTSW	5	144,753,380 (GRCm39)	missense	probably damaging	1.00
R4791:Trrap	UTSW	5	144,740,087 (GRCm39)	missense	probably damaging	1.00
R4795:Trrap	UTSW	5	144,769,298 (GRCm39)	missense	probably benign	0.06
R4827:Trrap	UTSW	5	144,737,758 (GRCm39)	missense	probably benign	0.02
R4839:Trrap	UTSW	5	144,782,402 (GRCm39)	missense	probably damaging	1.00
R4915:Trrap	UTSW	5	144,742,545 (GRCm39)	missense	probably damaging	0.99
R4951:Trrap	UTSW	5	144,742,530 (GRCm39)	missense	possibly damaging	0.65
R4959:Trrap	UTSW	5	144,793,770 (GRCm39)	missense	probably damaging	1.00
R5049:Trrap	UTSW	5	144,763,527 (GRCm39)	missense	probably damaging	1.00
R5074:Trrap	UTSW	5	144,787,989 (GRCm39)	missense	probably damaging	1.00
R5236:Trrap	UTSW	5	144,754,596 (GRCm39)	missense	probably benign	0.07
R5281:Trrap	UTSW	5	144,750,313 (GRCm39)	missense	probably benign	0.13
R5322:Trrap	UTSW	5	144,781,034 (GRCm39)	missense	probably damaging	1.00
R5457:Trrap	UTSW	5	144,786,787 (GRCm39)	missense	probably damaging	1.00
R5590:Trrap	UTSW	5	144,719,075 (GRCm39)	missense	probably benign	0.05
R5799:Trrap	UTSW	5	144,767,755 (GRCm39)	missense	probably benign
R5885:Trrap	UTSW	5	144,731,603 (GRCm39)	missense	probably damaging	1.00
R5905:Trrap	UTSW	5	144,786,730 (GRCm39)	missense	possibly damaging	0.95
R5908:Trrap	UTSW	5	144,723,518 (GRCm39)	missense	probably damaging	0.96
R5956:Trrap	UTSW	5	144,744,201 (GRCm39)	splice site	silent
R5992:Trrap	UTSW	5	144,746,994 (GRCm39)	missense	probably benign	0.00
R6017:Trrap	UTSW	5	144,781,051 (GRCm39)	missense	probably damaging	1.00
R6029:Trrap	UTSW	5	144,762,724 (GRCm39)	missense	possibly damaging	0.75
R6029:Trrap	UTSW	5	144,754,489 (GRCm39)	missense	possibly damaging	0.94
R6117:Trrap	UTSW	5	144,739,771 (GRCm39)	missense	possibly damaging	0.78
R6166:Trrap	UTSW	5	144,718,791 (GRCm39)	missense	possibly damaging	0.66
R6234:Trrap	UTSW	5	144,776,523 (GRCm39)	splice site	probably null
R6288:Trrap	UTSW	5	144,748,802 (GRCm39)	missense	probably damaging	1.00
R6290:Trrap	UTSW	5	144,741,828 (GRCm39)	missense	probably damaging	1.00
R6316:Trrap	UTSW	5	144,750,336 (GRCm39)	missense	probably benign	0.02
R6398:Trrap	UTSW	5	144,727,680 (GRCm39)	missense	possibly damaging	0.83
R6413:Trrap	UTSW	5	144,720,856 (GRCm39)	missense	possibly damaging	0.83
R6499:Trrap	UTSW	5	144,793,812 (GRCm39)	missense	probably damaging	1.00
R6529:Trrap	UTSW	5	144,771,014 (GRCm39)	missense	probably benign	0.06
R6574:Trrap	UTSW	5	144,752,360 (GRCm39)	critical splice donor site	probably null
R6631:Trrap	UTSW	5	144,708,460 (GRCm39)	missense	possibly damaging	0.94
R6727:Trrap	UTSW	5	144,793,760 (GRCm39)	missense	probably damaging	1.00
R6776:Trrap	UTSW	5	144,788,066 (GRCm39)	nonsense	probably null
R6914:Trrap	UTSW	5	144,720,853 (GRCm39)	missense	possibly damaging	0.83
R6942:Trrap	UTSW	5	144,720,853 (GRCm39)	missense	possibly damaging	0.83
R6945:Trrap	UTSW	5	144,727,665 (GRCm39)	missense	possibly damaging	0.66
R7023:Trrap	UTSW	5	144,728,964 (GRCm39)	missense	possibly damaging	0.64
R7107:Trrap	UTSW	5	144,733,945 (GRCm39)	missense	probably benign	0.05
R7139:Trrap	UTSW	5	144,739,988 (GRCm39)	missense	possibly damaging	0.65
R7148:Trrap	UTSW	5	144,758,613 (GRCm39)	missense	possibly damaging	0.77
R7167:Trrap	UTSW	5	144,776,424 (GRCm39)	missense	probably benign	0.39
R7171:Trrap	UTSW	5	144,730,859 (GRCm39)	missense	probably damaging	1.00
R7205:Trrap	UTSW	5	144,779,517 (GRCm39)	missense	possibly damaging	0.94
R7215:Trrap	UTSW	5	144,733,945 (GRCm39)	missense	probably benign	0.05
R7255:Trrap	UTSW	5	144,795,764 (GRCm39)	missense	probably damaging	1.00
R7261:Trrap	UTSW	5	144,782,287 (GRCm39)	missense	possibly damaging	0.67
R7264:Trrap	UTSW	5	144,751,333 (GRCm39)	missense	probably benign	0.05
R7372:Trrap	UTSW	5	144,726,208 (GRCm39)	missense	probably benign
R7447:Trrap	UTSW	5	144,776,284 (GRCm39)	missense	probably damaging	0.97
R7449:Trrap	UTSW	5	144,788,019 (GRCm39)	missense	probably damaging	1.00
R7655:Trrap	UTSW	5	144,779,422 (GRCm39)	missense	probably damaging	1.00
R7656:Trrap	UTSW	5	144,779,422 (GRCm39)	missense	probably damaging	1.00
R7662:Trrap	UTSW	5	144,769,321 (GRCm39)	missense	probably benign	0.00
R7716:Trrap	UTSW	5	144,713,956 (GRCm39)	missense	possibly damaging	0.73
R8143:Trrap	UTSW	5	144,772,707 (GRCm39)	splice site	probably null
R8183:Trrap	UTSW	5	144,765,343 (GRCm39)	missense	probably benign	0.01
R8265:Trrap	UTSW	5	144,722,344 (GRCm39)	missense	possibly damaging	0.53
R8273:Trrap	UTSW	5	144,727,975 (GRCm39)	missense	probably damaging	1.00
R8556:Trrap	UTSW	5	144,762,747 (GRCm39)	missense	probably benign	0.44
R8674:Trrap	UTSW	5	144,727,842 (GRCm39)	missense	probably benign	0.02
R8777:Trrap	UTSW	5	144,773,949 (GRCm39)	missense	probably benign	0.10
R8777-TAIL:Trrap	UTSW	5	144,773,949 (GRCm39)	missense	probably benign	0.10
R8817:Trrap	UTSW	5	144,782,348 (GRCm39)	missense	probably damaging	1.00
R8841:Trrap	UTSW	5	144,781,021 (GRCm39)	missense	probably damaging	1.00
R8871:Trrap	UTSW	5	144,758,649 (GRCm39)	missense	probably benign	0.30
R8937:Trrap	UTSW	5	144,757,063 (GRCm39)	missense	probably damaging	1.00
R8966:Trrap	UTSW	5	144,740,162 (GRCm39)	missense	probably damaging	0.96
R9010:Trrap	UTSW	5	144,783,226 (GRCm39)	missense	probably damaging	1.00
R9095:Trrap	UTSW	5	144,733,961 (GRCm39)	missense	probably damaging	1.00
R9127:Trrap	UTSW	5	144,767,830 (GRCm39)	missense	probably benign	0.16
R9132:Trrap	UTSW	5	144,726,362 (GRCm39)	missense	probably benign	0.03
R9224:Trrap	UTSW	5	144,708,049 (GRCm39)	missense	possibly damaging	0.70
R9338:Trrap	UTSW	5	144,727,925 (GRCm39)	missense	probably benign
R9380:Trrap	UTSW	5	144,769,981 (GRCm39)	missense	probably benign
R9404:Trrap	UTSW	5	144,752,225 (GRCm39)	missense	possibly damaging	0.85
R9457:Trrap	UTSW	5	144,763,478 (GRCm39)	missense	probably damaging	1.00
R9464:Trrap	UTSW	5	144,763,517 (GRCm39)	missense	probably damaging	0.99
R9504:Trrap	UTSW	5	144,742,904 (GRCm39)	missense	probably damaging	1.00
R9583:Trrap	UTSW	5	144,777,330 (GRCm39)	missense	probably damaging	1.00
R9584:Trrap	UTSW	5	144,777,330 (GRCm39)	missense	probably damaging	1.00
R9585:Trrap	UTSW	5	144,777,330 (GRCm39)	missense	probably damaging	1.00
R9608:Trrap	UTSW	5	144,780,128 (GRCm39)	missense	possibly damaging	0.60
R9728:Trrap	UTSW	5	144,726,193 (GRCm39)	missense	probably benign	0.22
R9782:Trrap	UTSW	5	144,758,716 (GRCm39)	missense	probably damaging	0.99
X0060:Trrap	UTSW	5	144,780,171 (GRCm39)	missense	probably damaging	0.96
Z1088:Trrap	UTSW	5	144,771,007 (GRCm39)	missense	probably benign	0.00
Z1177:Trrap	UTSW	5	144,756,518 (GRCm39)	missense	probably damaging	1.00
Z1177:Trrap	UTSW	5	144,747,154 (GRCm39)	missense
Z1177:Trrap	UTSW	5	144,793,761 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGCGTTCCAAATACTCGATG -3'
(R):5'- GGACCTTAGTGACACTATAAGGG -3'

Sequencing Primer
(F):5'- CCAAATACTCGATGGTCTCTGG -3'
(R):5'- TGTAACTAAGGACTACGGGCTGC -3'

Posted On

2014-10-02