Incidental Mutation 'R0660:Prkcb'
ID 208434
Institutional Source Beutler Lab
Gene Symbol Prkcb
Ensembl Gene ENSMUSG00000052889
Gene Name protein kinase C, beta
Synonyms Prkcb1, A130082F03Rik, Prkcb2, Pkcb, PKC-Beta
MMRRC Submission 038845-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0660 (G1)
Quality Score 49
Status Validated
Chromosome 7
Chromosomal Location 121888327-122233625 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 122024182 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 69 (V69A)
Ref Sequence ENSEMBL: ENSMUSP00000138788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064921] [ENSMUST00000064989] [ENSMUST00000143692]
AlphaFold P68404
Predicted Effect possibly damaging
Transcript: ENSMUST00000064921
AA Change: V69A

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064812
Gene: ENSMUSG00000052889
AA Change: V69A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 664 9.86e-27 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000064989
AA Change: V69A

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070019
Gene: ENSMUSG00000052889
AA Change: V69A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131167
Predicted Effect possibly damaging
Transcript: ENSMUST00000143692
AA Change: V69A

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000138788
Gene: ENSMUSG00000052889
AA Change: V69A

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
C1 37 86 7.11e-16 SMART
C1 102 151 1.42e-15 SMART
C2 172 275 1.05e-23 SMART
S_TKc 342 600 4.36e-97 SMART
S_TK_X 601 663 6.27e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149583
Meta Mutation Damage Score 0.1791 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.5%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. This protein kinase has been reported to be involved in many different cellular functions, such as B cell activation, apoptosis induction, endothelial cell proliferation, and intestinal sugar absorption. Studies in mice also suggest that this kinase may also regulate neuronal functions and correlate fear-induced conflict behavior after stress. Alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit impaired humoral immune responses, altered proliferative responses of B cells to various stimuli, abnormal vascular wound healing, and deficits in contextual and cued fear conditioning. ENU-induced mutations leadto impaired T cell-independent IgM responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530064D06Rik T C 17: 48,473,759 (GRCm39) I53V probably benign Het
Abtb3 G A 10: 85,224,234 (GRCm39) A348T possibly damaging Het
Actr3 T A 1: 125,336,304 (GRCm39) I129L probably benign Het
Armcx2 G A X: 133,706,385 (GRCm39) T416I possibly damaging Het
Aspm T A 1: 139,385,502 (GRCm39) M382K probably benign Het
Cacna1b A G 2: 24,544,458 (GRCm39) S1243P probably damaging Het
Cenpp C T 13: 49,618,173 (GRCm39) R244Q probably benign Het
Dock2 A G 11: 34,198,621 (GRCm39) S1444P probably damaging Het
Fmo4 T C 1: 162,637,417 (GRCm39) N25S probably benign Het
Ipo8 A T 6: 148,701,711 (GRCm39) L466I probably benign Het
Or5p6 T C 7: 107,630,822 (GRCm39) T243A probably damaging Het
Pnpla6 T C 8: 3,572,269 (GRCm39) probably benign Het
Sars1 G A 3: 108,338,789 (GRCm39) L247F probably damaging Het
Slco1a4 T C 6: 141,758,467 (GRCm39) I515V probably benign Het
Tanc1 A T 2: 59,674,228 (GRCm39) K1778* probably null Het
Zkscan3 A T 13: 21,572,630 (GRCm39) I167N probably damaging Het
Other mutations in Prkcb
AlleleSourceChrCoordTypePredicted EffectPPH Score
tilcara APN 7 122,194,228 (GRCm39) missense probably damaging 1.00
IGL02045:Prkcb APN 7 122,189,390 (GRCm39) missense probably damaging 1.00
IGL02273:Prkcb APN 7 122,226,990 (GRCm39) missense probably damaging 1.00
IGL02638:Prkcb APN 7 122,200,063 (GRCm39) splice site probably benign
IGL02962:Prkcb APN 7 122,024,270 (GRCm39) splice site probably null
IGL03013:Prkcb APN 7 122,226,905 (GRCm39) missense probably damaging 1.00
IGL03224:Prkcb APN 7 122,116,147 (GRCm39) nonsense probably null
Almonde UTSW 7 122,181,672 (GRCm39) missense probably damaging 1.00
Baghdad UTSW 7 122,226,886 (GRCm39) missense probably benign 0.07
Mesopotamia UTSW 7 121,888,737 (GRCm39) missense probably damaging 1.00
Mosul UTSW 7 122,116,067 (GRCm39) missense probably damaging 1.00
tigris UTSW 7 122,024,200 (GRCm39) missense probably damaging 1.00
Tikrit UTSW 7 122,226,916 (GRCm39) missense probably damaging 1.00
untied UTSW 7 122,181,662 (GRCm39) missense possibly damaging 0.90
F5770:Prkcb UTSW 7 122,127,699 (GRCm39) missense probably damaging 0.99
R0078:Prkcb UTSW 7 122,189,393 (GRCm39) missense probably damaging 1.00
R0409:Prkcb UTSW 7 122,024,200 (GRCm39) missense probably damaging 1.00
R1462:Prkcb UTSW 7 122,181,672 (GRCm39) missense probably damaging 1.00
R1462:Prkcb UTSW 7 122,181,672 (GRCm39) missense probably damaging 1.00
R1480:Prkcb UTSW 7 122,193,865 (GRCm39) missense probably damaging 1.00
R1518:Prkcb UTSW 7 122,143,854 (GRCm39) critical splice acceptor site probably null
R1540:Prkcb UTSW 7 122,226,916 (GRCm39) missense probably damaging 1.00
R1860:Prkcb UTSW 7 122,167,424 (GRCm39) missense probably damaging 1.00
R3110:Prkcb UTSW 7 122,116,079 (GRCm39) missense probably damaging 0.99
R3112:Prkcb UTSW 7 122,116,079 (GRCm39) missense probably damaging 0.99
R4583:Prkcb UTSW 7 122,056,447 (GRCm39) missense probably benign 0.32
R4847:Prkcb UTSW 7 122,167,372 (GRCm39) missense probably benign 0.35
R5220:Prkcb UTSW 7 121,888,678 (GRCm39) missense probably damaging 1.00
R5487:Prkcb UTSW 7 122,199,948 (GRCm39) nonsense probably null
R5599:Prkcb UTSW 7 122,181,701 (GRCm39) missense probably benign 0.17
R5946:Prkcb UTSW 7 122,143,926 (GRCm39) missense probably benign
R6257:Prkcb UTSW 7 122,167,386 (GRCm39) missense probably benign
R6590:Prkcb UTSW 7 121,888,737 (GRCm39) missense probably damaging 1.00
R6618:Prkcb UTSW 7 122,226,886 (GRCm39) missense probably benign 0.07
R6690:Prkcb UTSW 7 121,888,737 (GRCm39) missense probably damaging 1.00
R6763:Prkcb UTSW 7 122,193,887 (GRCm39) missense probably damaging 1.00
R7289:Prkcb UTSW 7 122,143,910 (GRCm39) missense probably benign 0.04
R7414:Prkcb UTSW 7 122,167,450 (GRCm39) missense possibly damaging 0.83
R7466:Prkcb UTSW 7 122,116,067 (GRCm39) missense probably damaging 1.00
R7540:Prkcb UTSW 7 122,167,357 (GRCm39) missense probably damaging 0.99
R8283:Prkcb UTSW 7 122,199,948 (GRCm39) nonsense probably null
R9072:Prkcb UTSW 7 122,127,771 (GRCm39) missense probably benign 0.14
R9483:Prkcb UTSW 7 122,181,663 (GRCm39) missense probably damaging 0.99
R9670:Prkcb UTSW 7 122,233,070 (GRCm39) nonsense probably null
V7581:Prkcb UTSW 7 122,127,699 (GRCm39) missense probably damaging 0.99
X0061:Prkcb UTSW 7 122,056,529 (GRCm39) missense probably benign 0.03
Z1177:Prkcb UTSW 7 122,167,419 (GRCm39) missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- ATGTGTGCAGTGGAGCCAGGTA -3'
(R):5'- GCACGATCAGAGTGAGGTCCTAGT -3'

Sequencing Primer
(F):5'- tcctgtctctgcctcctg -3'
(R):5'- CAGAGTGAGGTCCTAGTTGTTTCC -3'
Posted On 2014-06-26