Incidental Mutation 'R0041:Efna5'
ID201503
Institutional Source Beutler Lab
Gene Symbol Efna5
Ensembl Gene ENSMUSG00000048915
Gene Nameephrin A5
SynonymsEFL-5, Epl7, RAGS, AL-1, LERK-7, Ephrin-A5
MMRRC Submission 038335-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0041 (G1)
Quality Score44
Status Validated
Chromosome17
Chromosomal Location62604184-62881317 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 62607472 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000077883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076840] [ENSMUST00000078839]
Predicted Effect probably benign
Transcript: ENSMUST00000076840
SMART Domains Protein: ENSMUSP00000076115
Gene: ENSMUSG00000048915

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Ephrin 29 158 4.5e-42 PFAM
low complexity region 214 228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000078839
SMART Domains Protein: ENSMUSP00000077883
Gene: ENSMUSG00000048915

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Ephrin 26 164 2.4e-58 PFAM
low complexity region 187 201 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.8%
  • 20x: 96.3%
Validation Efficiency 97% (58/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ephrin-A5, a member of the ephrin gene family, prevents axon bundling in cocultures of cortical neurons with astrocytes, a model of late stage nervous system development and differentiation. The EPH and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, particularly in the nervous system. EPH receptors typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin ligands and receptors have been named by the Eph Nomenclature Committee (1997). Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. The Eph family of receptors are similarly divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit abnormalities in establishing correct axonal connections involving the retinal, motor, vomeronasal, and tactile axons to their respective targets. Some mutants develop neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik A T 6: 40,926,108 L110* probably null Het
Adamts13 A G 2: 26,983,974 R412G probably damaging Het
Adamts3 T A 5: 89,684,467 N927Y probably benign Het
Adgra3 A G 5: 49,960,559 Y1216H probably benign Het
Agpat3 C A 10: 78,288,047 probably benign Het
AI182371 T A 2: 35,085,721 Q277L possibly damaging Het
Arhgef15 A T 11: 68,954,516 L170Q possibly damaging Het
Avpi1 C A 19: 42,123,784 E112* probably null Het
Braf C T 6: 39,640,479 A534T probably damaging Het
Bspry G C 4: 62,486,554 A196P probably damaging Het
Cacna1c T A 6: 118,594,027 L2095F probably damaging Het
Cdhr2 A T 13: 54,726,838 S908C probably damaging Het
Cntnap5c C A 17: 57,876,469 Q57K probably benign Het
Dtna C T 18: 23,646,875 probably benign Het
Dynap A G 18: 70,242,034 S37P possibly damaging Het
Fancm T A 12: 65,106,443 C1224* probably null Het
Fbxw16 T A 9: 109,448,164 S37C probably damaging Het
Galnt4 A G 10: 99,108,512 Y33C probably benign Het
Kcnk2 G T 1: 189,295,691 N122K probably benign Het
Krt71 C A 15: 101,739,318 E222D probably damaging Het
Ltf T A 9: 111,029,568 D461E possibly damaging Het
Mapk4 A T 18: 73,935,038 L274Q probably damaging Het
Mbd6 A G 10: 127,286,872 C103R probably damaging Het
Nbeal1 A G 1: 60,281,871 N2047S probably benign Het
Nefh C T 11: 4,945,184 S335N possibly damaging Het
Obscn G T 11: 59,043,977 H4715N probably damaging Het
Olfml1 A T 7: 107,590,186 I153L possibly damaging Het
Olfr213 G A 6: 116,541,334 V294I possibly damaging Het
Olfr954 T A 9: 39,461,476 F12Y probably benign Het
Pck1 A G 2: 173,155,210 E215G probably benign Het
Peg12 T A 7: 62,463,560 E263V unknown Het
Phkg1 T A 5: 129,874,262 T15S probably benign Het
Plekhg1 T A 10: 3,964,076 L1120* probably null Het
Rlf T A 4: 121,149,929 H618L probably damaging Het
Rnf112 T A 11: 61,452,355 R165W probably damaging Het
Rnf213 A G 11: 119,402,575 T51A probably benign Het
Rnf220 A G 4: 117,273,284 L293P probably damaging Het
Rock1 T C 18: 10,140,240 D117G probably damaging Het
Rp1 A G 1: 4,344,628 V2087A probably benign Het
Rpl7a A G 2: 26,911,551 probably null Het
Serpinb6d A G 13: 33,667,632 D124G probably damaging Het
Skor1 T G 9: 63,145,851 T279P probably damaging Het
Son A T 16: 91,659,333 E1656V probably damaging Het
Swap70 A G 7: 110,279,355 K511E probably benign Het
Treh T C 9: 44,683,613 V262A probably benign Het
Trpm4 A G 7: 45,304,946 probably null Het
Ugt8a T C 3: 125,915,090 I124V probably benign Het
Wdr53 T C 16: 32,256,655 V226A probably damaging Het
Wdr64 G A 1: 175,726,471 W189* probably null Het
Other mutations in Efna5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Efna5 APN 17 62613379 missense possibly damaging 0.73
IGL02142:Efna5 APN 17 62607345 missense unknown
IGL02152:Efna5 APN 17 62651060 missense probably benign
IGL02534:Efna5 APN 17 62613389 nonsense probably null
IGL02556:Efna5 APN 17 62651028 missense probably damaging 0.99
R0265:Efna5 UTSW 17 62651073 missense probably damaging 1.00
R0422:Efna5 UTSW 17 62607419 missense probably benign 0.05
R0565:Efna5 UTSW 17 62881036 missense probably damaging 1.00
R2039:Efna5 UTSW 17 62881066 missense probably benign 0.00
R2570:Efna5 UTSW 17 62881028 missense probably benign 0.04
R4621:Efna5 UTSW 17 62651045 missense probably benign 0.00
R4622:Efna5 UTSW 17 62651045 missense probably benign 0.00
R5672:Efna5 UTSW 17 62881030 missense probably damaging 1.00
R5723:Efna5 UTSW 17 62607463 missense probably damaging 1.00
X0021:Efna5 UTSW 17 62607400 missense probably damaging 0.98
X0025:Efna5 UTSW 17 62651037 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCTGGTGTTCCAAGACCCTGAC -3'
(R):5'- AGTAGCCCATCCGAGTAGCTTCTG -3'

Sequencing Primer
(F):5'- ACATTTTCTGTGACAGGCGAC -3'
(R):5'- TGAAGGAAGTCCAATTTCCCCTG -3'
Posted On2014-06-13