Incidental Mutation 'W0251:Ipo5'
ID 166612
Institutional Source Beutler Lab
Gene Symbol Ipo5
Ensembl Gene ENSMUSG00000030662
Gene Name importin 5
Synonyms 1110011C18Rik, RanBP5, Kpnb3, importin beta 3, IMB3, 5730478E03Rik
Accession Numbers
Essential gene? Probably essential (E-score: 0.919) question?
Stock # W0251 (G3R) of strain daniel_gray
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 121148636-121185411 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 121176197 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 648 (M648K)
Ref Sequence ENSEMBL: ENSMUSP00000032898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032898]
AlphaFold Q8BKC5
Predicted Effect probably benign
Transcript: ENSMUST00000032898
AA Change: M648K

PolyPhen 2 Score 0.173 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000032898
Gene: ENSMUSG00000030662
AA Change: M648K

DomainStartEndE-ValueType
low complexity region 65 72 N/A INTRINSIC
Pfam:HEAT_2 359 467 3.3e-13 PFAM
Pfam:HEAT_EZ 372 426 3.7e-10 PFAM
Pfam:Vac14_Fab1_bd 373 430 3.8e-9 PFAM
Pfam:HEAT 400 430 4.2e-7 PFAM
Pfam:HEAT 906 936 4.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228277
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.0%
  • 10x: 95.5%
  • 20x: 90.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleocytoplasmic transport, a signal- and energy-dependent process, takes place through nuclear pore complexes embedded in the nuclear envelope. The import of proteins containing a nuclear localization signal (NLS) requires the NLS import receptor, a heterodimer of importin alpha and beta subunits also known as karyopherins. Importin alpha binds the NLS-containing cargo in the cytoplasm and importin beta docks the complex at the cytoplasmic side of the nuclear pore complex. In the presence of nucleoside triphosphates and the small GTP binding protein Ran, the complex moves into the nuclear pore complex and the importin subunits dissociate. Importin alpha enters the nucleoplasm with its passenger protein and importin beta remains at the pore. Interactions between importin beta and the FG repeats of nucleoporins are essential in translocation through the pore complex. The protein encoded by this gene is a member of the importin beta family. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(33) : Targeted, other(2) Gene trapped(31)

Other mutations in this stock
Total: 14 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl2a1b T A 9: 89,081,636 (GRCm39) M75K probably damaging Het
Btaf1 G A 19: 36,980,904 (GRCm39) R1575H probably damaging Het
Cfap46 T C 7: 139,183,862 (GRCm39) M2507V probably benign Het
Dcc T C 18: 71,959,154 (GRCm39) D206G probably damaging Het
Dnah6 T A 6: 73,155,501 (GRCm39) I705F possibly damaging Het
Entpd1 A T 19: 40,714,697 (GRCm39) I269F probably damaging Het
Gm4559 G C 7: 141,827,535 (GRCm39) A189G unknown Het
Kdelr1 A G 7: 45,531,045 (GRCm39) Y96C probably damaging Het
Mmp17 C T 5: 129,672,591 (GRCm39) A181V probably benign Het
Muc20 T C 16: 32,614,223 (GRCm39) I385V possibly damaging Het
Or13c7 C T 4: 43,855,058 (GRCm39) L250F probably benign Het
Pik3r6 A G 11: 68,424,697 (GRCm39) Y434C probably benign Het
Pura T C 18: 36,420,843 (GRCm39) V210A probably benign Het
Spic C T 10: 88,515,766 (GRCm39) D19N probably damaging Het
Other mutations in Ipo5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01461:Ipo5 APN 14 121,165,945 (GRCm39) missense probably damaging 0.98
IGL01614:Ipo5 APN 14 121,172,507 (GRCm39) missense probably benign 0.01
IGL01835:Ipo5 APN 14 121,163,650 (GRCm39) missense probably benign 0.24
IGL02010:Ipo5 APN 14 121,170,789 (GRCm39) missense probably benign 0.20
IGL02303:Ipo5 APN 14 121,154,795 (GRCm39) missense probably benign
IGL02344:Ipo5 APN 14 121,180,191 (GRCm39) splice site probably benign
IGL02657:Ipo5 APN 14 121,181,212 (GRCm39) missense possibly damaging 0.47
IGL03094:Ipo5 APN 14 121,181,089 (GRCm39) splice site probably benign
IGL03158:Ipo5 APN 14 121,179,303 (GRCm39) splice site probably benign
IGL03309:Ipo5 APN 14 121,157,416 (GRCm39) missense probably benign
IGL03392:Ipo5 APN 14 121,180,099 (GRCm39) missense probably damaging 0.99
3-1:Ipo5 UTSW 14 121,170,348 (GRCm39) missense probably benign 0.41
PIT4544001:Ipo5 UTSW 14 121,165,949 (GRCm39) missense probably damaging 0.99
R0326:Ipo5 UTSW 14 121,159,635 (GRCm39) missense probably benign 0.19
R0505:Ipo5 UTSW 14 121,180,145 (GRCm39) missense possibly damaging 0.74
R0559:Ipo5 UTSW 14 121,176,053 (GRCm39) missense probably damaging 1.00
R0590:Ipo5 UTSW 14 121,181,769 (GRCm39) missense possibly damaging 0.76
R0969:Ipo5 UTSW 14 121,181,937 (GRCm39) missense possibly damaging 0.64
R1450:Ipo5 UTSW 14 121,181,805 (GRCm39) missense probably benign 0.04
R1672:Ipo5 UTSW 14 121,170,714 (GRCm39) missense probably damaging 1.00
R2471:Ipo5 UTSW 14 121,159,574 (GRCm39) missense probably benign 0.12
R3508:Ipo5 UTSW 14 121,176,956 (GRCm39) missense probably damaging 1.00
R3696:Ipo5 UTSW 14 121,159,574 (GRCm39) missense probably benign 0.12
R4118:Ipo5 UTSW 14 121,176,073 (GRCm39) missense probably benign 0.04
R4418:Ipo5 UTSW 14 121,181,305 (GRCm39) missense possibly damaging 0.81
R4760:Ipo5 UTSW 14 121,179,054 (GRCm39) missense probably benign 0.02
R4839:Ipo5 UTSW 14 121,157,450 (GRCm39) missense probably benign 0.00
R4913:Ipo5 UTSW 14 121,172,498 (GRCm39) missense probably damaging 1.00
R5326:Ipo5 UTSW 14 121,163,683 (GRCm39) missense probably benign
R5339:Ipo5 UTSW 14 121,181,122 (GRCm39) missense probably damaging 1.00
R5483:Ipo5 UTSW 14 121,157,450 (GRCm39) missense probably benign 0.06
R5542:Ipo5 UTSW 14 121,163,683 (GRCm39) missense probably benign
R5579:Ipo5 UTSW 14 121,176,025 (GRCm39) missense probably benign 0.26
R5954:Ipo5 UTSW 14 121,157,396 (GRCm39) missense probably damaging 1.00
R6948:Ipo5 UTSW 14 121,160,527 (GRCm39) missense probably benign 0.00
R7365:Ipo5 UTSW 14 121,157,497 (GRCm39) missense probably benign
R7563:Ipo5 UTSW 14 121,183,567 (GRCm39) missense probably benign 0.00
R7782:Ipo5 UTSW 14 121,170,537 (GRCm39) missense possibly damaging 0.95
R7911:Ipo5 UTSW 14 121,167,051 (GRCm39) splice site probably null
R8222:Ipo5 UTSW 14 121,157,414 (GRCm39) missense probably benign 0.00
R8238:Ipo5 UTSW 14 121,172,652 (GRCm39) missense probably damaging 1.00
R8483:Ipo5 UTSW 14 121,183,560 (GRCm39) missense probably benign
R8826:Ipo5 UTSW 14 121,157,366 (GRCm39) missense probably damaging 1.00
R9042:Ipo5 UTSW 14 121,160,547 (GRCm39) missense probably benign 0.01
X0062:Ipo5 UTSW 14 121,179,083 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- AAAGAATTCCAGCAGTACCTTCCCG -3'
(R):5'- TCCTCTGAACTGAGTTTGTGTGCC -3'

Sequencing Primer
(F):5'- TTCACCAGGACATGGTAGCT -3'
(R):5'- TGTGCGCTCACACACATAC -3'
Posted On 2014-04-13