Incidental Mutation 'R1208:4930432E11Rik'
ID 164823
Institutional Source Beutler Lab
Gene Symbol 4930432E11Rik
Ensembl Gene ENSMUSG00000046958
Gene Name RIKEN cDNA 4930432E11 gene
Synonyms
MMRRC Submission 039277-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R1208 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 29255998-29276204 bp(+) (GRCm39)
Type of Mutation exon
DNA Base Change (assembly) C to A at 29260708 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053635
SMART Domains Protein: ENSMUSP00000049518
Gene: ENSMUSG00000046958

DomainStartEndE-ValueType
Blast:WD40 43 79 3e-11 BLAST
WD40 131 172 1.97e2 SMART
WD40 175 214 2.24e-2 SMART
Blast:WD40 257 296 4e-15 BLAST
WD40 393 437 1.32e2 SMART
WD40 494 533 2.15e-4 SMART
low complexity region 598 617 N/A INTRINSIC
low complexity region 1082 1094 N/A INTRINSIC
low complexity region 1107 1148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000063585
SMART Domains Protein: ENSMUSP00000063695
Gene: ENSMUSG00000051976

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
internal_repeat_1 35 67 3.29e-5 PROSPERO
internal_repeat_1 73 102 3.29e-5 PROSPERO
low complexity region 122 135 N/A INTRINSIC
coiled coil region 161 182 N/A INTRINSIC
low complexity region 216 233 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185541
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl2fm3 C T 3: 59,772,715 (GRCm39) P73L probably benign Het
Asb14 T C 14: 26,622,375 (GRCm39) probably benign Het
Atp13a3 A T 16: 30,173,065 (GRCm39) C271S probably benign Het
Ccl25 T A 8: 4,407,631 (GRCm39) S199T possibly damaging Het
Cdh15 G C 8: 123,584,234 (GRCm39) E112Q probably damaging Het
Cep104 A T 4: 154,069,836 (GRCm39) D270V probably damaging Het
Dnah5 T A 15: 28,327,877 (GRCm39) Y2084N probably damaging Het
Eftud2 A G 11: 102,755,592 (GRCm39) V214A probably benign Het
Epb41l4b C T 4: 57,077,252 (GRCm39) probably null Het
Gys2 A G 6: 142,396,193 (GRCm39) probably null Het
Lig4 T C 8: 10,021,062 (GRCm39) E906G probably damaging Het
Mast3 G A 8: 71,240,916 (GRCm39) probably null Het
Mta2 G A 19: 8,928,381 (GRCm39) R560H probably damaging Het
Myom2 T C 8: 15,134,631 (GRCm39) L478P probably damaging Het
Neb A T 2: 52,193,912 (GRCm39) L673* probably null Het
Niban3 A T 8: 72,053,119 (GRCm39) T125S probably damaging Het
Or4c35 G A 2: 89,808,836 (GRCm39) C238Y probably damaging Het
Pdpk1 C A 17: 24,312,583 (GRCm39) probably null Het
Pphln1 T C 15: 93,357,610 (GRCm39) W162R probably damaging Het
Ppp1r13b A G 12: 111,811,339 (GRCm39) V183A probably damaging Het
Recql5 T C 11: 115,783,982 (GRCm39) K951E probably damaging Het
Rev1 T C 1: 38,098,199 (GRCm39) probably benign Het
Slc25a25 T C 2: 32,307,437 (GRCm39) E309G probably benign Het
Slc25a36 T C 9: 96,967,188 (GRCm39) probably benign Het
Sycp2 A T 2: 177,998,421 (GRCm39) I1033N possibly damaging Het
Tbpl2 A T 2: 23,984,783 (GRCm39) N120K probably benign Het
Unc5b A T 10: 60,602,771 (GRCm39) L876Q probably damaging Het
Usp9y T C Y: 1,356,282 (GRCm39) T1140A probably benign Homo
Vmn1r40 A G 6: 89,691,326 (GRCm39) I48V probably benign Het
Zbbx T C 3: 74,945,299 (GRCm39) I708V possibly damaging Het
Zfp318 AGAAGA AGAAGAGGAAGA 17: 46,723,446 (GRCm39) probably benign Het
Other mutations in 4930432E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:4930432E11Rik APN 7 29,273,426 (GRCm39) unclassified noncoding transcript
IGL01955:4930432E11Rik APN 7 29,273,420 (GRCm39) unclassified noncoding transcript
IGL01971:4930432E11Rik APN 7 29,273,987 (GRCm39) unclassified noncoding transcript
IGL02132:4930432E11Rik APN 7 29,262,704 (GRCm39) unclassified noncoding transcript
IGL02484:4930432E11Rik APN 7 29,262,777 (GRCm39) unclassified noncoding transcript
P0016:4930432E11Rik UTSW 7 29,262,537 (GRCm39) unclassified noncoding transcript
R0051:4930432E11Rik UTSW 7 29,278,526 (GRCm39) exon noncoding transcript
R0060:4930432E11Rik UTSW 7 29,273,595 (GRCm39) unclassified noncoding transcript
R0094:4930432E11Rik UTSW 7 29,260,236 (GRCm39) exon noncoding transcript
R0268:4930432E11Rik UTSW 7 29,274,027 (GRCm39) unclassified noncoding transcript
R0423:4930432E11Rik UTSW 7 29,261,825 (GRCm39) exon noncoding transcript
R0478:4930432E11Rik UTSW 7 29,262,014 (GRCm39) exon noncoding transcript
R0646:4930432E11Rik UTSW 7 29,260,710 (GRCm39) exon noncoding transcript
R1778:4930432E11Rik UTSW 7 29,260,131 (GRCm39) exon noncoding transcript
R1779:4930432E11Rik UTSW 7 29,278,591 (GRCm39) exon noncoding transcript
R1918:4930432E11Rik UTSW 7 29,273,514 (GRCm39) unclassified noncoding transcript
R2360:4930432E11Rik UTSW 7 29,274,214 (GRCm39) unclassified noncoding transcript
R3736:4930432E11Rik UTSW 7 29,273,996 (GRCm39) unclassified noncoding transcript
R3780:4930432E11Rik UTSW 7 29,260,263 (GRCm39) exon noncoding transcript
R4427:4930432E11Rik UTSW 7 29,278,678 (GRCm39) exon noncoding transcript
R4835:4930432E11Rik UTSW 7 29,274,326 (GRCm39) unclassified noncoding transcript
R4929:4930432E11Rik UTSW 7 29,273,467 (GRCm39) unclassified noncoding transcript
R5042:4930432E11Rik UTSW 7 29,273,927 (GRCm39) unclassified noncoding transcript
R5129:4930432E11Rik UTSW 7 29,260,786 (GRCm39) exon noncoding transcript
R5371:4930432E11Rik UTSW 7 29,261,918 (GRCm39) exon noncoding transcript
R5381:4930432E11Rik UTSW 7 29,262,393 (GRCm39) unclassified noncoding transcript
R5586:4930432E11Rik UTSW 7 29,277,153 (GRCm39) unclassified noncoding transcript
R5874:4930432E11Rik UTSW 7 29,280,610 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TGTGTGCCACAGAACACCTTCTATG -3'
(R):5'- CAGGAAGCGCAGTAAACTGTCCTC -3'

Sequencing Primer
(F):5'- CCTTCTATGCTGGAAACAAGAATGG -3'
(R):5'- AGTAAACTGTCCTCTGTGGCAC -3'
Posted On 2014-03-28