Mutagenetix > Incidental Mutation

Incidental Mutation 'R1339:4921517D22Rik'

156968

Institutional Source

Beutler Lab

Gene Symbol

4921517D22Rik

Ensembl Gene

ENSMUSG00000049902

Gene Name

RIKEN cDNA 4921517D22 gene

Synonyms

MMRRC Submission

039404-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.073) question?

Stock #

R1339 (G1)

Quality Score

217

Status

Not validated

Chromosome

Chromosomal Location

59835216-59841917 bp(-) (GRCm39)

Type of Mutation

frame shift

DNA Base Change (assembly)

GCC to GC at 59839412 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000153380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061597] [ENSMUST00000225373]

AlphaFold

Q8CET0

Predicted Effect

probably null
Transcript: ENSMUST00000061597

Predicted Effect

probably null
Transcript: ENSMUST00000225373

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225788

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.1%
3x: 98.2%
10x: 96.1%
20x: 92.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts20	A	T	15: 94,220,777 (GRCm39)	N1385K	probably benign	Het
Cplane2	A	G	4: 140,945,859 (GRCm39)	E134G	probably damaging	Het
Cyp4a32	A	G	4: 115,468,760 (GRCm39)	Y382C	probably damaging	Het
Dtnbp1	G	A	13: 45,076,696 (GRCm39)	S237L	probably damaging	Het
Foxi1	T	C	11: 34,155,866 (GRCm39)	T255A	probably benign	Het
Ifi208	A	C	1: 173,510,804 (GRCm39)	T320P	probably damaging	Het
Inhbc	C	A	10: 127,193,510 (GRCm39)	V169L	probably benign	Het
Irf7	G	A	7: 140,843,617 (GRCm39)	R320C	probably damaging	Het
Marchf6	T	C	15: 31,486,548 (GRCm39)	T336A	probably benign	Het
Masp1	C	A	16: 23,271,217 (GRCm39)	C677F	probably damaging	Het
Mei1	A	G	15: 81,966,196 (GRCm39)	R323G	possibly damaging	Het
Or2a7	G	C	6: 43,151,544 (GRCm39)	G208A	probably benign	Het
Or6k8-ps1	G	T	1: 173,979,777 (GRCm39)	G232C	probably damaging	Het
Pira13	A	G	7: 3,825,155 (GRCm39)	Y496H	probably damaging	Het
Rel	C	T	11: 23,695,763 (GRCm39)	C208Y	probably damaging	Het
Shc2	T	G	10: 79,462,250 (GRCm39)	T298P	probably benign	Het
Syne1	G	A	10: 5,317,571 (GRCm39)	L508F	probably damaging	Het
Ubn1	A	G	16: 4,873,199 (GRCm39)	K74E	probably damaging	Het

Other mutations in 4921517D22Rik

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00827:4921517D22Rik	APN	13	59,837,290 (GRCm39)	missense	probably benign	0.00
IGL01516:4921517D22Rik	APN	13	59,838,548 (GRCm39)	missense	probably benign	0.00
PIT4677001:4921517D22Rik	UTSW	13	59,838,305 (GRCm39)	missense	probably benign	0.12
R0395:4921517D22Rik	UTSW	13	59,837,470 (GRCm39)	missense	possibly damaging	0.94
R0579:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R0664:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R0757:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R0758:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R0777:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R0779:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R0814:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R0870:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R0872:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R0873:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1062:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1064:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1149:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1149:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1151:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1152:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1207:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1207:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1285:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1358:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1359:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1360:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1361:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R1679:4921517D22Rik	UTSW	13	59,839,412 (GRCm39)	frame shift	probably null
R4703:4921517D22Rik	UTSW	13	59,837,342 (GRCm39)	missense	possibly damaging	0.94
R4785:4921517D22Rik	UTSW	13	59,839,406 (GRCm39)	missense	probably benign
R4823:4921517D22Rik	UTSW	13	59,838,718 (GRCm39)	missense	probably damaging	0.99
R5054:4921517D22Rik	UTSW	13	59,837,315 (GRCm39)	missense	probably damaging	0.97
R6144:4921517D22Rik	UTSW	13	59,837,347 (GRCm39)	missense	probably damaging	0.99
R6977:4921517D22Rik	UTSW	13	59,839,394 (GRCm39)	missense	possibly damaging	0.66
R7009:4921517D22Rik	UTSW	13	59,838,624 (GRCm39)	missense	possibly damaging	0.89
R7791:4921517D22Rik	UTSW	13	59,838,508 (GRCm39)	missense	probably benign
R8319:4921517D22Rik	UTSW	13	59,838,486 (GRCm39)	missense	probably benign
R8422:4921517D22Rik	UTSW	13	59,839,443 (GRCm39)	start codon destroyed	probably null	0.01
R8520:4921517D22Rik	UTSW	13	59,838,423 (GRCm39)	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TGAAATGAAACTCCGGTGCCCC -3'
(R):5'- TCACCAATGAAATGGTCAGAGCTGC -3'

Sequencing Primer
(F):5'- CGCCTGCATGTGGTATCATA -3'
(R):5'- GCTACTTGAAACATGATTGACTCGAC -3'

Posted On

2014-02-11