Incidental Mutation 'R1343:Hoxa13'
ID 156427
Institutional Source Beutler Lab
Gene Symbol Hoxa13
Ensembl Gene ENSMUSG00000038203
Gene Name homeobox A13
Synonyms Hox-1.10
MMRRC Submission 039408-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1343 (G1)
Quality Score 140
Status Not validated
Chromosome 6
Chromosomal Location 52235833-52237865 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) CCG to CCGCG at 52237618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000039170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047993] [ENSMUST00000114416] [ENSMUST00000147595]
AlphaFold Q62424
Predicted Effect probably null
Transcript: ENSMUST00000047993
SMART Domains Protein: ENSMUSP00000039170
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
low complexity region 37 81 N/A INTRINSIC
Pfam:HoxA13_N 136 219 6.2e-25 PFAM
HOX 317 379 1.16e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114416
SMART Domains Protein: ENSMUSP00000110059
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 55 1e-19 PFAM
HOX 153 215 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141300
Predicted Effect probably benign
Transcript: ENSMUST00000147595
SMART Domains Protein: ENSMUSP00000125221
Gene: ENSMUSG00000038203

DomainStartEndE-ValueType
Pfam:HoxA13_N 1 39 8.3e-11 PFAM
HOX 137 199 1.16e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152875
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185179
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185112
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] In vertebrates, the genes encoding the class of transcription factors called homeobox genes are found in clusters named A, B, C, and D on four separate chromosomes. Expression of these proteins is spatially and temporally regulated during embryonic development. This gene is part of the A cluster on chromosome 7 and encodes a DNA-binding transcription factor which may regulate gene expression, morphogenesis, and differentiation. Expansion of a polyalanine tract in the encoded protein can cause hand-foot-uterus syndrome, also known as hand-foot-genital syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit agenesis of both the urinary bladder and the caudal portion of the Mullerian ducts, premature stenosis of the umbilical arteries, loss of the most anterior digit of all feet, and death around mid-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankle2 T C 5: 110,385,832 (GRCm39) V361A probably damaging Het
Art1 A G 7: 101,756,160 (GRCm39) Y117C probably damaging Het
Cecr2 T C 6: 120,731,672 (GRCm39) Y215H probably damaging Het
Col6a3 T C 1: 90,696,069 (GRCm39) E2666G unknown Het
Cps1 T A 1: 67,248,768 (GRCm39) V1165E probably damaging Het
Gpr65 A T 12: 98,241,888 (GRCm39) K180N probably benign Het
Gsto2 A T 19: 47,873,146 (GRCm39) probably null Het
Kif19a A G 11: 114,676,653 (GRCm39) D494G probably benign Het
Lnx1 T C 5: 74,758,040 (GRCm39) R695G probably damaging Het
Lonp1 A G 17: 56,927,272 (GRCm39) L327P probably damaging Het
Nat8 T C 6: 85,807,603 (GRCm39) T177A probably damaging Het
Nek1 T A 8: 61,481,709 (GRCm39) M208K probably damaging Het
Obsl1 G T 1: 75,469,223 (GRCm39) H1239Q probably damaging Het
Or52n2b A G 7: 104,565,834 (GRCm39) I223T probably damaging Het
Pdlim2 C T 14: 70,402,228 (GRCm39) R296H probably damaging Het
Pirb A T 7: 3,720,637 (GRCm39) L287Q probably benign Het
Prmt3 C T 7: 49,467,856 (GRCm39) S354L probably benign Het
Ralgapa1 T A 12: 55,754,763 (GRCm39) H1176L probably damaging Het
Serpinb9h G A 13: 33,588,468 (GRCm39) C351Y possibly damaging Het
Slc35e1 T C 8: 73,246,415 (GRCm39) probably benign Het
Strc T C 2: 121,195,596 (GRCm39) S1618G probably benign Het
Syne2 T C 12: 76,080,417 (GRCm39) S4784P probably damaging Het
Usp14 T C 18: 10,016,623 (GRCm39) T73A probably benign Het
Vmn2r53 G A 7: 12,318,701 (GRCm39) P458L probably benign Het
Zfp292 T C 4: 34,805,238 (GRCm39) D2602G probably damaging Het
Other mutations in Hoxa13
AlleleSourceChrCoordTypePredicted EffectPPH Score
H8786:Hoxa13 UTSW 6 52,260,636 (GRCm38) frame shift probably null
PIT4131001:Hoxa13 UTSW 6 52,260,648 (GRCm38) utr 5 prime probably benign
PIT4131001:Hoxa13 UTSW 6 52,260,647 (GRCm38) utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52,260,648 (GRCm38) utr 5 prime probably benign
PIT4142001:Hoxa13 UTSW 6 52,260,647 (GRCm38) utr 5 prime probably benign
R0458:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R0496:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R0502:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R0512:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R0784:Hoxa13 UTSW 6 52,236,917 (GRCm39) missense probably damaging 0.98
R1062:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R1157:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R1192:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R1310:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R1341:Hoxa13 UTSW 6 52,237,618 (GRCm39) frame shift probably null
R1398:Hoxa13 UTSW 6 52,260,648 (GRCm38) utr 5 prime probably benign
R1398:Hoxa13 UTSW 6 52,260,647 (GRCm38) utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52,260,648 (GRCm38) utr 5 prime probably benign
R1400:Hoxa13 UTSW 6 52,260,647 (GRCm38) utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52,260,648 (GRCm38) utr 5 prime probably benign
R1450:Hoxa13 UTSW 6 52,260,647 (GRCm38) utr 5 prime probably benign
R1632:Hoxa13 UTSW 6 52,236,917 (GRCm39) missense probably damaging 0.98
R2382:Hoxa13 UTSW 6 52,236,125 (GRCm39) missense probably damaging 0.98
R3149:Hoxa13 UTSW 6 52,237,284 (GRCm39) intron probably benign
R4012:Hoxa13 UTSW 6 52,236,107 (GRCm39) missense possibly damaging 0.47
R4426:Hoxa13 UTSW 6 52,237,714 (GRCm39) utr 5 prime probably benign
R5535:Hoxa13 UTSW 6 52,237,520 (GRCm39) frame shift probably null
R6175:Hoxa13 UTSW 6 52,236,908 (GRCm39) missense probably damaging 0.98
R7365:Hoxa13 UTSW 6 52,236,862 (GRCm39) missense probably damaging 1.00
R7770:Hoxa13 UTSW 6 52,237,247 (GRCm39) critical splice acceptor site probably benign
R7926:Hoxa13 UTSW 6 52,237,619 (GRCm39) frame shift probably null
R7931:Hoxa13 UTSW 6 52,237,620 (GRCm39) frame shift probably null
R8960:Hoxa13 UTSW 6 52,236,976 (GRCm39) missense probably benign 0.03
R8982:Hoxa13 UTSW 6 52,235,916 (GRCm39) nonsense probably null
R9060:Hoxa13 UTSW 6 52,236,897 (GRCm39) missense probably damaging 1.00
R9698:Hoxa13 UTSW 6 52,236,024 (GRCm39) missense probably benign 0.00
X0018:Hoxa13 UTSW 6 52,237,099 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TGCGTAGCCCTGATGGTAGAAAGC -3'
(R):5'- TTAAAACAGCGCCACTGGGGTC -3'

Sequencing Primer
(F):5'- TGCCGAAGTAGCCGTAGG -3'
(R):5'- ACTGGGGTCTTCTCCATGC -3'
Posted On 2014-02-11