Incidental Mutation 'R1257:Zeb1'
ID 151509
Institutional Source Beutler Lab
Gene Symbol Zeb1
Ensembl Gene ENSMUSG00000024238
Gene Name zinc finger E-box binding homeobox 1
Synonyms Nil2, Tcf18, 3110032K11Rik, Zfhep, ZEB, AREB6, Tcf8, Zfhx1a, MEB1, Tw, [delta]EF1, Zfx1a
MMRRC Submission 039324-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R1257 (G1)
Quality Score 207
Status Not validated
Chromosome 18
Chromosomal Location 5591860-5775467 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 5772699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 996 (R996L)
Ref Sequence ENSEMBL: ENSMUSP00000025081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025081]
AlphaFold Q64318
Predicted Effect possibly damaging
Transcript: ENSMUST00000025081
AA Change: R996L

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000025081
Gene: ENSMUSG00000024238
AA Change: R996L

DomainStartEndE-ValueType
low complexity region 13 30 N/A INTRINSIC
ZnF_C2H2 150 173 3.16e-3 SMART
ZnF_C2H2 180 202 3.21e-4 SMART
ZnF_C2H2 220 242 4.87e-4 SMART
ZnF_C2H2 248 268 1.86e1 SMART
low complexity region 288 304 N/A INTRINSIC
low complexity region 532 555 N/A INTRINSIC
HOX 559 621 7.53e-3 SMART
low complexity region 730 742 N/A INTRINSIC
low complexity region 766 783 N/A INTRINSIC
ZnF_C2H2 882 904 1.18e-2 SMART
ZnF_C2H2 910 932 4.4e-2 SMART
ZnF_C2H2 938 959 1.89e-1 SMART
coiled coil region 1006 1077 N/A INTRINSIC
low complexity region 1096 1112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162892
SMART Domains Protein: ENSMUSP00000124677
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 94 117 1.3e-5 SMART
ZnF_C2H2 124 146 1.3e-6 SMART
ZnF_C2H2 164 186 2e-6 SMART
ZnF_C2H2 192 212 7.8e-2 SMART
low complexity region 232 248 N/A INTRINSIC
low complexity region 476 499 N/A INTRINSIC
HOX 503 565 3.9e-5 SMART
low complexity region 674 686 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177030
SMART Domains Protein: ENSMUSP00000135865
Gene: ENSMUSG00000024238

DomainStartEndE-ValueType
ZnF_C2H2 22 44 4.87e-4 SMART
low complexity region 277 300 N/A INTRINSIC
HOX 304 366 7.53e-3 SMART
low complexity region 475 487 N/A INTRINSIC
low complexity region 511 528 N/A INTRINSIC
ZnF_C2H2 627 649 1.18e-2 SMART
ZnF_C2H2 655 677 4.4e-2 SMART
ZnF_C2H2 683 704 1.89e-1 SMART
low complexity region 758 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 95.9%
  • 20x: 91.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a zinc finger transcription factor. The encoded protein likely plays a role in transcriptional repression of interleukin 2. Mutations in this gene have been associated with posterior polymorphous corneal dystrophy-3 and late-onset Fuchs endothelial corneal dystrophy. Alternatively spliced transcript variants encoding different isoforms have been described.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mutations at this locus affect thymus organization and homozygotes exhibit severe thymic T cell deficiency. Some mutations result in eye anomalies and extensive skeletal abnormalities. Homozygotes generally die at birth due to respiratory failure. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl A T 2: 127,886,286 (GRCm39) T174S probably benign Het
Ank3 C T 10: 69,710,665 (GRCm39) R408* probably null Het
Ceacam15 A G 7: 16,405,949 (GRCm39) S201P possibly damaging Het
Ceacam20 A G 7: 19,708,117 (GRCm39) I241V probably benign Het
Cfap46 A T 7: 139,234,545 (GRCm39) L237* probably null Het
Col4a3 T A 1: 82,694,086 (GRCm39) C133S probably damaging Het
Dnajc9 G A 14: 20,438,765 (GRCm39) probably null Het
Dnhd1 T A 7: 105,343,360 (GRCm39) V1568D probably damaging Het
Gli3 C T 13: 15,900,581 (GRCm39) Q1323* probably null Het
Grhpr A G 4: 44,989,045 (GRCm39) N287S probably damaging Het
H2bl1 A T 13: 99,121,023 (GRCm39) M1K probably null Het
Hectd4 G A 5: 121,456,687 (GRCm39) W684* probably null Het
Kifc3 A G 8: 95,832,400 (GRCm39) V474A probably damaging Het
Lrrc37 A G 11: 103,425,467 (GRCm39) V1462A unknown Het
Mdn1 A T 4: 32,667,089 (GRCm39) probably null Het
Med7 C G 11: 46,331,460 (GRCm39) I18M probably damaging Het
Nid1 T C 13: 13,658,375 (GRCm39) Y707H probably benign Het
Nol4 A T 18: 22,903,738 (GRCm39) N339K probably damaging Het
Or6c209 A T 10: 129,483,413 (GRCm39) K139* probably null Het
Rbm34 C T 8: 127,697,643 (GRCm39) G23S possibly damaging Het
Rps19bp1 CCTTCTTCTTCTTCTTCTTCTT CCTTCTTCTTCTTCTTCTT 15: 80,145,250 (GRCm39) probably benign Het
Shf G A 2: 122,199,163 (GRCm39) P51S probably damaging Het
Snap25 A T 2: 136,600,268 (GRCm39) E37V probably damaging Het
Taf1a A G 1: 183,179,175 (GRCm39) T118A possibly damaging Het
Tasor2 T C 13: 3,625,049 (GRCm39) T1634A probably benign Het
Thrb T A 14: 18,008,642 (GRCm38) I122K probably damaging Het
Xkr4 T G 1: 3,287,036 (GRCm39) I385L probably benign Het
Other mutations in Zeb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Zeb1 APN 18 5,767,774 (GRCm39) missense probably benign 0.00
IGL01139:Zeb1 APN 18 5,705,061 (GRCm39) missense possibly damaging 0.69
IGL01444:Zeb1 APN 18 5,767,138 (GRCm39) missense probably benign
IGL01444:Zeb1 APN 18 5,767,906 (GRCm39) missense probably damaging 1.00
IGL01806:Zeb1 APN 18 5,767,867 (GRCm39) missense possibly damaging 0.94
IGL01988:Zeb1 APN 18 5,759,037 (GRCm39) nonsense probably null
IGL02059:Zeb1 APN 18 5,766,892 (GRCm39) missense probably damaging 1.00
IGL03005:Zeb1 APN 18 5,767,150 (GRCm39) missense probably benign 0.03
IGL03153:Zeb1 APN 18 5,770,511 (GRCm39) missense probably damaging 1.00
Apes UTSW 18 5,761,394 (GRCm39) missense probably damaging 1.00
cellophane UTSW 18 5,770,554 (GRCm39) nonsense probably null
serpens UTSW 18 5,772,455 (GRCm39) missense probably damaging 1.00
N/A - 293:Zeb1 UTSW 18 5,767,076 (GRCm39) missense possibly damaging 0.68
R0184:Zeb1 UTSW 18 5,766,808 (GRCm39) missense probably damaging 1.00
R0488:Zeb1 UTSW 18 5,772,455 (GRCm39) missense probably damaging 1.00
R0622:Zeb1 UTSW 18 5,759,123 (GRCm39) nonsense probably null
R0646:Zeb1 UTSW 18 5,759,027 (GRCm39) missense probably damaging 1.00
R0881:Zeb1 UTSW 18 5,767,138 (GRCm39) missense probably benign
R1251:Zeb1 UTSW 18 5,705,089 (GRCm39) missense probably damaging 1.00
R1501:Zeb1 UTSW 18 5,761,399 (GRCm39) missense possibly damaging 0.95
R1547:Zeb1 UTSW 18 5,767,450 (GRCm39) missense possibly damaging 0.50
R1797:Zeb1 UTSW 18 5,766,298 (GRCm39) nonsense probably null
R1815:Zeb1 UTSW 18 5,767,898 (GRCm39) missense probably damaging 1.00
R2090:Zeb1 UTSW 18 5,766,458 (GRCm39) missense possibly damaging 0.65
R2129:Zeb1 UTSW 18 5,767,681 (GRCm39) missense possibly damaging 0.92
R2875:Zeb1 UTSW 18 5,772,859 (GRCm39) small insertion probably benign
R3888:Zeb1 UTSW 18 5,748,743 (GRCm39) missense probably damaging 1.00
R3941:Zeb1 UTSW 18 5,767,799 (GRCm39) missense probably benign 0.06
R3952:Zeb1 UTSW 18 5,772,716 (GRCm39) missense probably benign 0.17
R4271:Zeb1 UTSW 18 5,758,985 (GRCm39) missense probably damaging 0.99
R4512:Zeb1 UTSW 18 5,759,007 (GRCm39) missense probably damaging 1.00
R4514:Zeb1 UTSW 18 5,759,007 (GRCm39) missense probably damaging 1.00
R4677:Zeb1 UTSW 18 5,766,775 (GRCm39) missense probably damaging 0.97
R4729:Zeb1 UTSW 18 5,767,286 (GRCm39) missense probably damaging 1.00
R5839:Zeb1 UTSW 18 5,767,507 (GRCm39) missense probably benign
R5913:Zeb1 UTSW 18 5,766,765 (GRCm39) missense possibly damaging 0.49
R6248:Zeb1 UTSW 18 5,766,962 (GRCm39) missense probably damaging 1.00
R6354:Zeb1 UTSW 18 5,772,743 (GRCm39) missense possibly damaging 0.64
R6429:Zeb1 UTSW 18 5,770,498 (GRCm39) missense probably damaging 1.00
R6819:Zeb1 UTSW 18 5,591,917 (GRCm39) missense probably damaging 1.00
R7180:Zeb1 UTSW 18 5,767,867 (GRCm39) missense possibly damaging 0.94
R7193:Zeb1 UTSW 18 5,772,756 (GRCm39) missense probably damaging 0.98
R7199:Zeb1 UTSW 18 5,767,703 (GRCm39) missense probably benign 0.00
R7397:Zeb1 UTSW 18 5,761,394 (GRCm39) missense probably damaging 1.00
R7534:Zeb1 UTSW 18 5,766,611 (GRCm39) missense probably damaging 1.00
R7702:Zeb1 UTSW 18 5,766,802 (GRCm39) missense probably damaging 1.00
R7703:Zeb1 UTSW 18 5,766,917 (GRCm39) missense probably benign
R7934:Zeb1 UTSW 18 5,748,703 (GRCm39) missense probably benign 0.00
R8504:Zeb1 UTSW 18 5,705,127 (GRCm39) missense possibly damaging 0.94
R8539:Zeb1 UTSW 18 5,748,784 (GRCm39) missense probably damaging 0.99
R8716:Zeb1 UTSW 18 5,767,958 (GRCm39) missense probably damaging 0.99
R8772:Zeb1 UTSW 18 5,770,382 (GRCm39) critical splice acceptor site probably null
R8824:Zeb1 UTSW 18 5,748,680 (GRCm39) splice site probably benign
R9082:Zeb1 UTSW 18 5,772,557 (GRCm39) missense probably damaging 0.98
R9085:Zeb1 UTSW 18 5,766,716 (GRCm39) missense probably damaging 1.00
R9456:Zeb1 UTSW 18 5,766,709 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGGGGAAAAGCCCTATCAATGTGAC -3'
(R):5'- CACTGTACCATCAGTCTTGGCTGC -3'

Sequencing Primer
(F):5'- GCCCTATCAATGTGACAAGTGTG -3'
(R):5'- tcctcctcttcctcctcttc -3'
Posted On 2014-01-29