Incidental Mutation 'R1284:Cimip2c'
ID 150647
Institutional Source Beutler Lab
Gene Symbol Cimip2c
Ensembl Gene ENSMUSG00000029182
Gene Name ciliary microtubule inner protein 2C
Synonyms Fam166c, 1700001C02Rik
MMRRC Submission 039350-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1284 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 30623395-30641433 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 30637851 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glycine to Glutamic Acid at position 66 (G66E)
Ref Sequence ENSEMBL: ENSMUSP00000142583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031078] [ENSMUST00000114743] [ENSMUST00000127815] [ENSMUST00000199129]
AlphaFold Q9DAS2
Predicted Effect probably damaging
Transcript: ENSMUST00000031078
AA Change: G66E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031078
Gene: ENSMUSG00000029182
AA Change: G66E

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 2.3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000114743
AA Change: G66E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110391
Gene: ENSMUSG00000029182
AA Change: G66E

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 1e-26 PFAM
low complexity region 125 137 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127815
AA Change: G66E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142635
Gene: ENSMUSG00000029182
AA Change: G66E

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 5.6e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199129
AA Change: G66E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142583
Gene: ENSMUSG00000029182
AA Change: G66E

DomainStartEndE-ValueType
Pfam:DUF2475 19 84 3.7e-23 PFAM
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.2%
  • 10x: 96.2%
  • 20x: 92.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 3 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
F5 G C 1: 164,026,486 (GRCm39) R1686P probably damaging Het
Sp140l2 C T 1: 85,247,776 (GRCm39) G4S probably damaging Het
Spopfm1 A G 3: 94,173,102 (GRCm39) M37V probably benign Het
Other mutations in Cimip2c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1285:Cimip2c UTSW 5 30,637,851 (GRCm39) missense probably damaging 1.00
R1286:Cimip2c UTSW 5 30,637,851 (GRCm39) missense probably damaging 1.00
R1287:Cimip2c UTSW 5 30,637,851 (GRCm39) missense probably damaging 1.00
R1699:Cimip2c UTSW 5 30,641,210 (GRCm39) critical splice acceptor site probably null
R2109:Cimip2c UTSW 5 30,637,851 (GRCm39) missense probably damaging 1.00
R3735:Cimip2c UTSW 5 30,639,442 (GRCm39) missense probably benign 0.03
R3736:Cimip2c UTSW 5 30,639,442 (GRCm39) missense probably benign 0.03
R7571:Cimip2c UTSW 5 30,639,502 (GRCm39) missense possibly damaging 0.93
R9522:Cimip2c UTSW 5 30,623,467 (GRCm39) missense probably damaging 1.00
R9631:Cimip2c UTSW 5 30,639,529 (GRCm39) missense
R9715:Cimip2c UTSW 5 30,641,261 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TCAGTCATCAAAAGCCCGCCTG -3'
(R):5'- CTCTGCCCCTGGAACTCTGAAAAG -3'

Sequencing Primer
(F):5'- AAAGCCCGCCTGGGAAC -3'
(R):5'- TCTGAAAAGGCAACCCTGTCTC -3'
Posted On 2014-01-29