Incidental Mutations

694 incidental mutations are currently displayed, and affect 159 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
694 are Probably Benign.
0 are Probably Null.
0 create premature stop codons.
0 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 694] next >> last >| per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 207681 UTSW 1110038F14Rik R1845 G1 131 N 15 76949663 CGGG CGGGGGG small insertion Het probably benign 06/23/2014
2 313366 UTSW 1110038F14Rik R4023 G1 153 N 15 76949663 CGGG CGGGGGG small insertion Het probably benign 04/30/2015
3 510963 UTSW 4930402H24Rik 0.144 FR4304 198.47 N 2 130770748 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
4 511206 UTSW 4930402H24Rik 0.144 FR4342 156.47 N 2 130770742 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
5 511319 UTSW 4930402H24Rik 0.144 FR4589 203.47 N 2 130770745 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
6 511320 UTSW 4930402H24Rik 0.144 FR4589 142.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
7 511589 UTSW 4930402H24Rik 0.144 FR4737 145.47 N 2 130770752 CC CCTGC small insertion Het probably benign phenotype 04/05/2018
8 511807 UTSW 4930402H24Rik 0.144 FR4976 150.47 N 2 130770739 TCC TCCCCC small insertion Het probably benign phenotype 04/05/2018
9 511808 UTSW 4930402H24Rik 0.144 FR4976 147.47 N 2 130770742 TCC TCCACC small insertion Het probably benign phenotype 04/05/2018
10 511809 UTSW 4930402H24Rik 0.144 FR4976 135.47 N 2 130770753 C CTCG small insertion Het probably benign phenotype 04/05/2018
11 512078 UTSW 4932415D10Rik 0.145 FR4548 214.46 N 10 82290996 G GTCATTA small insertion Homo probably benign 04/05/2018
12 156747 UTSW 4933415A04Rik R1332 G1 155 N 11 43587429 T TNNNNNNNNNNNNNNNNNN small insertion Het probably benign 02/11/2014
13 510980 UTSW Ahdc1 0.466 FR4304 214.46 N 4 133062759 CT CTCTT small insertion Homo probably benign phenotype 04/05/2018
14 512028 UTSW Ahdc1 0.466 FR4548 214.46 N 4 133062757 TCC TCCCCC small insertion Homo probably benign phenotype 04/05/2018
15 512029 UTSW Ahdc1 0.466 FR4548 214.46 N 4 133062760 T TCCC small insertion Homo probably benign phenotype 04/05/2018
16 511617 UTSW Ahdc1 0.466 FR4737 214.46 N 4 133062759 CT CTCGT small insertion Homo probably benign phenotype 04/05/2018
17 262108 UTSW Ahdc1 0.466 T0722 G3 217 N 711 4 133062754 ACCTCCT ACCTCCTCCT small insertion Het probably benign phenotype 02/04/2015
18 262152 UTSW Ahdc1 0.466 T0975 G3 108 N 714 4 133062754 ACCTCCT ACCTCCTCCT small insertion Het probably benign phenotype 02/04/2015
19 512139 UTSW AI837181 0.169 FR4548 131.47 N 19 5425231 CGG CGGGGG small insertion Het probably benign 04/05/2018
20 512140 UTSW AI837181 0.169 FR4548 132.49 N 19 5425237 CG CGGGG small insertion Het probably benign 04/05/2018
21 511980 UTSW AI837181 0.169 FR4976 111.47 N 19 5425229 GGC GGCCGC small insertion Het probably benign 04/05/2018
22 511897 UTSW Akap12 0.145 FR4976 218.26 N 10 4353837 AAA AAACAA small insertion Het probably benign phenotype 04/05/2018
23 511011 UTSW Alpk3 0.647 FR4304 217.47 N 7 81077762 TCT TCTGCT small insertion Het probably benign phenotype 04/05/2018
24 511661 UTSW Alpk3 0.647 FR4737 210.48 N 7 81077762 TCT TCTACT small insertion Het probably benign phenotype 04/05/2018
26 511074 UTSW Ankhd1 0.341 FR4304 217.47 N 18 36560924 GGCGGC GGCGGCTGCGGC small insertion Het probably benign 04/05/2018
27 511258 UTSW Anxa2 0.000 FR4342 130.47 N 9 69480205 CCC CCCACC small insertion Het probably benign phenotype 04/05/2018
28 511259 UTSW Anxa2 0.000 FR4342 154.47 N 9 69480210 C CCCA small insertion Het probably benign phenotype 04/05/2018
29 512069 UTSW Anxa2 0.000 FR4548 104.47 N 9 69480203 CCC CCCTCC small insertion Het probably benign phenotype 04/05/2018
30 511365 UTSW Anxa2 0.000 FR4589 149.47 N 9 69480210 C CCCA small insertion Het probably benign phenotype 04/05/2018
31 510951 UTSW Arhgap30 0.147 FR4304 217.47 N 1 171405168 TGGCCC TGGCCCTGGCCCAGGCCTTGGCCCCGGCCC small insertion Het probably benign 04/05/2018
32 511538 UTSW Arid1b 0.452 FR4449 102.47 N 17 4995589 CGG CGGTGG small insertion Het probably benign phenotype 04/05/2018
33 258600 UTSW Asap3 0.162 R3703 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
34 258643 UTSW Asap3 0.162 R3704 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
35 258694 UTSW Asap3 0.162 R3705 G1 217 Y 4 136241241 TGAGGAGGAGGAGGAGGA TGAGGAGGAGGAGGAGGAGGA small insertion Het probably benign 0.116 phenotype 01/23/2015
38 96244 UTSW AU022751 0.025 R1015 G1 217 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 01/05/2014
39 98227 UTSW AU022751 0.025 R1102 G1 214 Y X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 01/05/2014
40 168588 UTSW AU022751 0.025 R1513 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 04/13/2014
41 209501 UTSW AU022751 0.025 R1885 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
42 209606 UTSW AU022751 0.025 R1886 G1 214 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
43 209700 UTSW AU022751 0.025 R1887 G1 152 N X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 06/30/2014
44 225804 UTSW AU022751 0.025 R1996 G1 214 Y X 6082591 GTCATCATCATCATC GTCATCATCATCATCATC small insertion Het probably benign 0.102 08/25/2014
45 511528 UTSW B430218F22Rik 0.102 FR4449 215.1 N 13 118386851 CGGCG CGGCGATGGCG small insertion Homo probably benign 04/05/2018
48 543747 UTSW BC028528 0.056 R6980 G1 217.47 N 3 95888168 CACTGGTTCTGTGGT CACTGGTTCTGTGGTTACTGGTTCTGTGGT small insertion Het probably benign 05/13/2019
50 549887 UTSW BC028528 0.056 R7086 G1 217.47 N 3 95888137 TCACTGGTTCTGT TCACTGGTTCTGTTGGCACTGGTTCTGT small insertion Het probably benign 05/15/2019
51 549888 UTSW BC028528 0.056 R7086 G1 217.47 N 3 95888166 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG small insertion Het probably benign 05/15/2019
53 558886 UTSW BC028528 0.056 R7180 G1 217.47 N 3 95888182 TCACTGGTT TCACTGGTTCTGTGGACACTGGTT small insertion Het probably benign 06/26/2019
55 567378 UTSW BC028528 0.056 R7308 G1 217.47 N 3 95888152 TCACTGGTTCTGTGGTCACTGGTTCTGTGG TCACTGGTTCTGTGGCCACTGGTTCTGTGGTCACTGGTTCTGTGG small insertion Het probably benign 06/26/2019
56 567379 UTSW BC028528 0.056 R7308 G1 217.47 N 3 95888169 ACTGGTTCTGTGGTC ACTGGTTCTGTGGTCCCTGGTTCTGTGGTC small insertion Het probably benign 06/26/2019
59 567480 UTSW BC028528 0.056 R7310 G1 217.47 N 3 95888148 G GGGGTCACTGGTTCTT small insertion Het probably benign 06/26/2019
60 567481 UTSW BC028528 0.056 R7310 G1 217.47 N 3 95888173 GTTCTGTGGTCACTG GTTCTGTGGTCACTGATTCTGTGGTCACTG small insertion Het probably benign 06/26/2019
61 527100 UTSW Bcl9l 0.815 R6670 G1 217.47 Y 9 44507072 GTGAACATGAACATGAACATGAAC GTGAACATGAACATGAACATGAACATGAAC small insertion Het probably benign phenotype 07/23/2018
62 237150 UTSW Bdp1 0.923 R2180 G1 194 N 13 100061405 ATTCTTCTTCTTCTTCTTC ATTCTTCTTCTTCTTCTTCTTC small insertion Het probably benign phenotype 10/02/2014
63 511010 UTSW Blm 1.000 FR4304 181.47 N 7 80512919 TCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
64 511132 UTSW Blm 1.000 FR4340 178.47 N 7 80512907 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCGCCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
65 511133 UTSW Blm 1.000 FR4340 195.47 N 7 80512910 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
66 511483 UTSW Blm 1.000 FR4449 176.47 N 7 80512908 CCTCCTCCTCCTCCTCCTCCTCCT CCTCCTCCTCCTTCTCCTCCTCCTCCTCCTCCTCCT small insertion Het probably benign phenotype 04/05/2018
67 511869 UTSW Blm 1.000 FR4976 217.47 N 7 80512907 TCCTCCTCCTCCTCCTCCTCCTCC TCCTCCTCCTCCACCTCCTCCTCCTCCTCCTCCTCC small insertion Het probably benign phenotype 04/05/2018
68 511021 UTSW Btnl10 0.142 FR4304 214.46 N 11 58923930 GA GAATA small insertion Homo probably benign 04/05/2018
69 511511 UTSW Btnl10 0.142 FR4449 214.46 N 11 58923928 AAG AAGGAG small insertion Homo probably benign 04/05/2018
70 511382 UTSW Btnl10 0.142 FR4589 214.46 N 11 58923929 AGA AGAGGA small insertion Homo probably benign 04/05/2018
71 511694 UTSW Btnl10 0.142 FR4737 214.46 N 11 58923931 A AAGG small insertion Homo probably benign 04/05/2018
72 511909 UTSW Btnl10 0.142 FR4976 212.47 N 11 58923929 AGA AGAGGA small insertion Homo probably benign 04/05/2018
73 511141 UTSW Cacna1a 0.775 FR4340 153.47 N 8 84638723 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
74 511486 UTSW Cacna1a 0.775 FR4449 217.47 N 8 84638714 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
75 511487 UTSW Cacna1a 0.775 FR4449 217.47 N 8 84638720 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
76 511488 UTSW Cacna1a 0.775 FR4449 217.47 N 8 84638723 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
77 512062 UTSW Cacna1a 0.775 FR4548 217.47 N 8 84638717 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
78 511668 UTSW Cacna1a 0.775 FR4737 217.49 N 8 84638720 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
79 511669 UTSW Cacna1a 0.775 FR4737 214.46 N 8 84638726 ACC ACCCCC small insertion Homo probably benign phenotype 04/05/2018
80 511880 UTSW Cacna1a 0.775 FR4976 217.47 N 8 84638717 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
81 511881 UTSW Cacna1a 0.775 FR4976 217.73 N 8 84638726 ACC ACCTCC small insertion Het probably benign phenotype 04/05/2018
83 511015 UTSW Ccdc170 0.190 FR4304 130.47 N 10 4561021 CCA CCATCA small insertion Het probably benign phenotype 04/05/2018
84 512075 UTSW Ccdc170 0.190 FR4548 118.47 N 10 4561026 ACC ACCCCC small insertion Het probably benign phenotype 04/05/2018
85 511688 UTSW Ccdc170 0.190 FR4737 188.47 N 10 4561023 ACC ACCTCC small insertion Het probably benign phenotype 04/05/2018
86 511689 UTSW Ccdc170 0.190 FR4737 128.51 N 10 4561029 AC ACCCC small insertion Het probably benign phenotype 04/05/2018
87 511898 UTSW Ccdc170 0.190 FR4976 142.47 N 10 4561008 ACCGCC ACCGCCGCC small insertion Het probably benign phenotype 04/05/2018
88 511899 UTSW Ccdc170 0.190 FR4976 170.47 N 10 4561023 ACC ACCGCC small insertion Het probably benign phenotype 04/05/2018
89 511900 UTSW Ccdc170 0.190 FR4976 173.88 N 10 4561029 AC ACCTC small insertion Het probably benign phenotype 04/05/2018
90 511033 UTSW Ccdc85c 0.359 FR4304 189.73 N 12 108274612 GCC GCCCCC small insertion Het probably benign phenotype 04/05/2018
91 511526 UTSW Ccdc85c 0.359 FR4449 141.54 N 12 108274616 CCG CCGACG small insertion Het probably benign phenotype 04/05/2018
92 555259 UTSW Ccnjl 0.247 PIT4431001 G1 101.47 N 11 43579707 CGCG CGCGGCG small insertion Het probably benign 06/07/2019
93 511057 UTSW Cd80 0.155 FR4304 214.46 N 16 38486315 AGA AGAGGA small insertion Homo probably benign phenotype 04/05/2018
94 511179 UTSW Cd80 0.155 FR4340 214.46 N 16 38486316 GAA GAAAAA small insertion Homo probably benign phenotype 04/05/2018
95 512124 UTSW Cd80 0.155 FR4548 207.54 N 16 38486319 GAAA GAAAAAA small insertion Homo probably benign phenotype 04/05/2018
96 511527 UTSW Cdhr2 0.070 FR4449 214.49 N 13 54725924 AGTC AGTCGTC small insertion Homo probably benign phenotype 04/05/2018
97 511440 UTSW Cdk15 0.215 FR4449 218 N 1 59257823 A ATCTAAAAGG small insertion Homo probably benign 04/05/2018
98 225363 UTSW Cdkn1b 0.831 R2005 G1 217 N 6 134921956 ATTCTTCTTC ATTCTTCTTCTTC small insertion Het probably benign phenotype 08/25/2014
99 511557 UTSW Cdx1 0.645 FR4449 217.47 N 18 61019881 GCTG GCTGCTCCTG small insertion Het probably benign phenotype 04/05/2018
100 511763 UTSW Cdx1 0.645 FR4737 217.47 N 18 61019874 TGCTGC TGCTGCCGCTGC small insertion Het probably benign phenotype 04/05/2018
[records 1 to 100 of 694] next >> last >|