Incidental Mutations

2,203 incidental mutations are currently displayed, and affect 1,764 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
138 are Probably Benign.
2,032 are Probably Null.
0 create premature stop codons.
2,203 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 2203] next >> last >| per page Full List
ID question?
Source question?
Gene question?
E-score question?
Stock # question?
Gen question?
Vld question?
Strain question?
Chr question?
Position question?
Mutation question?
Type question?
Exon Dist question?
Zygosity question?
Predicted Effect question?
PPH Score question?
Meta Score question?
MGI Phenotype question?
Posted question?
1 192678 UTSW 1110017D15Rik 0.069 R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 0.542 phenotype 05/23/2014
2 192500 UTSW 1700001C02Rik 0.243 R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
3 538049 UTSW 1700011H14Rik 0.029 R6841 G1 225.01 Y 14 49243813 T C critical splice acceptor site Het probably null 10/18/2018
4 388197 UTSW 1700017D01Rik 0.061 R5099 G1 225 Y 19 11112461 T C critical splice acceptor site Het probably null 0.650 06/06/2016
5 478683 UTSW 1700019A02Rik 0.142 R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
6 190952 UTSW 1700023F06Rik 0.034 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
7 409841 APN 1700029H14Rik 0.025 IGL03069 8 13557704 T G critical splice acceptor site Het probably null 08/02/2016
8 39342 UTSW 1700067P10Rik 0.016 R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 0.600 05/23/2013
9 379571 UTSW 2010111I01Rik 0.188 R4911 G1 225 Y 13 63170939 A T critical splice acceptor site Het probably null 0.492 phenotype 04/15/2016
10 26543 UTSW 2010315B03Rik 0.088 P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
11 60600 UTSW 2010315B03Rik 0.088 R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
12 60571 UTSW 2010315B03Rik 0.088 R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
13 22264 UTSW 2010315B03Rik 0.088 R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
14 500098 UTSW 2010315B03Rik 0.088 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
15 31421 UTSW 2010315B03Rik 0.088 R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/24/2013
16 76984 UTSW 2010315B03Rik 0.088 R0775 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
17 76493 UTSW 2010315B03Rik 0.088 R0798 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
18 89620 APN 2300002M23Rik 0.135 IGL01527 G1 17 35567833 G T critical splice acceptor site Het probably null phenotype 12/03/2013
19 406142 UTSW 2310022A10Rik 0.159 R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 0.486 07/28/2016
20 180063 APN 2700062C07Rik 0.754 IGL01919 G1 18 24475523 A G critical splice acceptor site Het probably null 05/07/2014
21 208042 UTSW 4430402I18Rik 0.104 R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 0.486 06/23/2014
22 462735 UTSW 4833423E24Rik 0.063 R5765 G1 225 Y 2 85484194 T G critical splice acceptor site Het probably null 0.644 03/01/2017
23 278029 APN 4921507P07Rik 0.117 IGL00852 G1 6 50589184 T A critical splice acceptor site Het probably null 04/16/2015
24 382658 UTSW 4921507P07Rik 0.117 R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably null 04/27/2016
25 318775 UTSW 4921524L21Rik 0.104 R4201 G1 225 N 18 6623952 A G critical splice acceptor site Het probably null 06/10/2015
26 370200 UTSW 4930430A15Rik 0.040 R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 0.476 02/04/2016
27 507928 UTSW 4930452B06Rik 0.097 R6280 G1 225.01 Y 14 8473414 T G critical splice acceptor site Het probably null 0.550 03/15/2018
28 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
29 482208 UTSW 4930579C12Rik 0.131 R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
30 511096 UTSW 4932438A13Rik 0.882 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
31 511596 UTSW 4932438A13Rik 0.882 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
32 53494 APN 4932438A13Rik 0.882 IGL01019 G1 3 37006984 G T critical splice acceptor site Het probably null phenotype 06/28/2013
33 212811 UTSW 4932438A13Rik 0.882 R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null phenotype 07/14/2014
34 532627 UTSW 4932438A13Rik 0.882 R6792 G1 225.01 Y 3 37011566 A G critical splice acceptor site Het probably null phenotype 08/29/2018
35 57694 UTSW 5430403G16Rik 0.117 R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 0.520 07/11/2013
36 241496 UTSW 5430419D17Rik 0.039 R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
37 241616 UTSW 5430419D17Rik 0.039 R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
38 249756 UTSW 5830473C10Rik 0.313 R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
39 376254 UTSW 9930111J21Rik1 0.130 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
40 420239 APN A2m 0.000 IGL03369 6 121676903 G A critical splice acceptor site Het probably null phenotype 08/02/2016
41 436215 UTSW A2ml1 0.234 R5532 G1 225 N 6 128553330 T A critical splice acceptor site Het probably null 10/24/2016
42 166432 UTSW A430105I19Rik 0.066 R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
43 391994 UTSW A530016L24Rik 0.017 IGL02835 G1 153 Y 12 112494986 A C critical splice acceptor site Het probably null 0.644 06/08/2016
44 345326 UTSW A830018L16Rik 0.155 R4598 G1 225 N 1 11747964 G A critical splice acceptor site Het probably null phenotype 09/25/2015
45 479514 UTSW A830018L16Rik 0.155 R6007 G1 225.01 Y 1 11511916 A G critical splice acceptor site Het probably null 0.522 phenotype 06/26/2017
46 302040 APN Aadacl4 0.098 IGL02648 4 144617822 A T critical splice acceptor site Het probably null 04/16/2015
47 102103 UTSW Aak1 0.221 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null phenotype 01/15/2014
48 479868 UTSW Aanat 0.051 R6013 G1 225.01 Y 11 116596124 A T critical splice acceptor site Het probably null 0.458 phenotype 06/26/2017
49 204589 UTSW Aass 0.325 R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably null phenotype 06/23/2014
50 12430 APN Abca12 1.000 IGL00813 G1 1 71353762 C A critical splice acceptor site Het probably null phenotype 12/06/2012
51 489401 UTSW Abca13 0.143 R6153 G1 225.01 Y 11 9301259 G T critical splice acceptor site Het probably null 0.480 phenotype 10/10/2017
52 4474 APN Abca5 0.201 IGL00487 G1 11 110309450 T A critical splice acceptor site Het probably null phenotype 04/20/2012
53 349067 UTSW Abca6 0.129 R4629 G1 225 N 11 110230549 T C critical splice acceptor site Het probably null phenotype 10/08/2015
54 217018 UTSW Abca8a 0.100 R1962 G1 222 N 11 110026905 T C critical splice acceptor site Het probably null 08/01/2014
55 486155 UTSW Abca8a 0.100 R6090 G1 225.01 N 11 110063222 T C critical splice acceptor site Het probably null 08/16/2017
56 204725 UTSW Abca8b 0.301 R1819 G1 225 Y 11 109981056 T C critical splice acceptor site Het probably null 0.448 phenotype 06/23/2014
57 280532 APN Abcb11 0.000 IGL02119 2 69328000 T A critical splice acceptor site Het probably null phenotype 04/16/2015
58 49312 UTSW Abcb1b 0.345 R0533 G1 225 Y 5 8864113 A T critical splice acceptor site Het probably null 0.598 phenotype 06/12/2013
59 314451 UTSW Abcb4 0.000 R4112 G1 225 Y 5 8936783 A G critical splice acceptor site Het probably null 0.550 phenotype 05/14/2015
60 346036 UTSW Abcb5 0.266 R4606 G1 225 Y 12 118932610 T C critical splice acceptor site Het probably null 0.582 phenotype 09/25/2015
61 521932 UTSW Abcb6 0.753 R6527 G1 225.01 N 1 75177488 T C critical splice acceptor site Het probably null phenotype 06/06/2018
62 261898 UTSW Abcb9 0.182 R0458 G1 73 Y 5 124082146 C A critical splice acceptor site Het probably null 0.568 phenotype 02/04/2015
63 275295 UTSW Abcc3 0.000 R3824 G1 184 Y 11 94368620 T C critical splice acceptor site Het probably null 0.564 phenotype 04/02/2015
64 448782 UTSW Abcc9 0.228 R5802 G1 225 Y 6 142656676 C A critical splice acceptor site Het probably null 0.568 phenotype 12/15/2016
65 283488 APN Abcd2 0.174 IGL02084 15 91178327 T A critical splice acceptor site Het probably null phenotype 04/16/2015
66 22524 UTSW Abcd4 0.431 R0144 G1 225 Y 12 84605965 T A critical splice acceptor site Het probably null 0.572 phenotype 04/16/2013
67 416821 APN Abcf2 0.348 IGL03329 5 24571248 T G critical splice acceptor site Het probably null phenotype 08/02/2016
68 214910 UTSW Abcg8 0.000 R1916 G1 225 Y 17 84688530 A T critical splice acceptor site Het probably null 0.470 phenotype 07/14/2014
69 58394 UTSW Abhd12 0.443 R0617 G1 180 Y 2 150846365 T A critical splice acceptor site Het probably null 0.452 phenotype 07/11/2013
70 316602 UTSW Abhd12 0.443 R4077 G1 225 Y 2 150848459 T A critical splice acceptor site Het probably null 0.536 phenotype 05/15/2015
71 76737 UTSW Abi3bp 0.138 R0783 G1 186 Y 16 56595238 A G critical splice acceptor site Het probably null 0.454 10/16/2013
72 61397 UTSW Abraxas2 0.350 R0670 G1 113 N 7 132869031 A T critical splice acceptor site Het probably null 07/30/2013
73 440160 UTSW Abtb2 0.237 R5513 G1 203 Y 2 103709278 A T critical splice acceptor site Het probably null 0.466 11/08/2016
74 266910 UTSW Acaa1a 0.193 R3418 G1 225 Y 9 119349490 A G critical splice acceptor site Het probably null 0.564 phenotype 02/18/2015
75 48328 UTSW Acaca 1.000 R0518 G1 225 N 11 84290286 A G critical splice acceptor site Het probably null phenotype 06/12/2013
76 524617 UTSW Acaca 1.000 R6623 G1 225.01 Y 11 84371499 A C critical splice acceptor site Het probably null phenotype 06/22/2018
77 326220 UTSW Acacb 0.000 R4386 G1 207 Y 5 114241921 A T critical splice acceptor site Het probably null 0.580 phenotype 07/06/2015
78 183777 APN Acad9 0.814 IGL02016 G1 3 36088486 A T critical splice acceptor site Het probably null phenotype 05/07/2014
79 389143 UTSW Acadsb 0.148 R5020 G1 225 Y 7 131441200 A T critical splice acceptor site Het probably null 0.542 phenotype 06/06/2016
80 484254 UTSW Acap1 0.000 R6053 G1 225.01 N 11 69887070 T G critical splice acceptor site Het probably null 07/14/2017
81 330387 UTSW Accsl 0.072 R4472 G1 225 Y 2 93863991 T A critical splice acceptor site Het probably null 0.486 07/21/2015
82 209805 UTSW Aco1 0.519 R1889 G1 225 Y 4 40164607 A T critical splice acceptor site Het probably null 0.500 phenotype 06/30/2014
83 523065 UTSW Acsm3 0.000 R6497 G1 225.01 Y 7 119780749 G A critical splice acceptor site Het probably null 0.458 phenotype 06/06/2018
84 157015 UTSW Actn1 0.500 R1340 G1 224 Y 12 80173144 T C critical splice acceptor site Het probably null 0.566 phenotype 02/11/2014
85 402748 UTSW Actn2 0.652 R5228 G1 225 N 13 12288659 T C critical splice acceptor site Het probably null phenotype 07/22/2016
86 462619 UTSW Actn3 0.000 R5753 G1 225 Y 19 4864567 T C critical splice acceptor site Het probably null 0.508 phenotype 03/01/2017
87 43485 UTSW Adam32 0.215 R0189 G1 154 Y 8 24922337 T A critical splice acceptor site Het probably null 0.464 phenotype 05/24/2013
88 527180 UTSW Adam7 0.061 R6672 G1 225.01 Y 14 68504702 T A critical splice acceptor site Het probably null 0.580 phenotype 07/23/2018
89 544235 UTSW Adamts16 0.135 R6996 G1 225.01 N 13 70798038 C T critical splice acceptor site Het probably null phenotype 05/13/2019
90 538409 UTSW Adamts2 0.175 R6897 G1 225.01 Y 11 50737164 A T critical splice acceptor site Het probably null phenotype 11/06/2018
91 36286 UTSW Adamts6 0.740 R0362 G1 214 Y 13 104390076 A G critical splice acceptor site Het probably null 0.530 phenotype 05/09/2013
92 427459 UTSW Adamtsl1 0.184 R5411 G1 225 N 4 86388413 G A critical splice acceptor site Het probably null phenotype 09/01/2016
93 289550 APN Adamtsl5 0.048 IGL02352 10 80343728 T A critical splice acceptor site Het probably null 04/16/2015
94 290442 APN Adamtsl5 0.048 IGL02359 10 80343728 T A critical splice acceptor site Het probably null 04/16/2015
95 42073 UTSW Adcy4 0.000 R0482 G1 225 Y 14 55774572 T A critical splice acceptor site Het probably null 0.526 phenotype 05/23/2013
96 537769 UTSW Adcy8 0.152 R6823 G1 225.01 Y 15 64754886 T G critical splice acceptor site Het probably null phenotype 10/18/2018
97 435084 UTSW Adgrb2 0.000 R5550 G1 225 N 4 130014934 G T critical splice acceptor site Het probably null phenotype 10/24/2016
98 357788 UTSW Adgrf3 0.108 R4754 G1 225 Y 5 30197617 T A critical splice acceptor site Het probably null 0.472 11/11/2015
99 1004 APN Adgrv1 0.000 IGL00090 G1 13 81405408 T G critical splice acceptor site Het probably null phenotype 07/12/2011
100 168020 UTSW Adgrv1 0.000 R1507 G1 225 Y 13 81472580 T C critical splice acceptor site Het probably null 0.452 phenotype 04/13/2014
[records 1 to 100 of 2203] next >> last >|