Incidental Mutations

9,846 incidental mutations are currently displayed, and affect 6,051 genes.
0 are Possibly Damaging.
0 are Probably Damaging.
236 are Probably Benign.
9,437 are Probably Null.
0 create premature stop codons.
9,846 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 9846] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 46973 UTSW 0610009O20Rik 0.201 R0511 G1 225 Y 18 38254071 T C critical splice donor site 2 bp Het probably null 0.532 06/11/2013
2 326976 UTSW 0610009O20Rik 0.201 R4418 G1 225 Y 18 38261287 T C critical splice donor site 2 bp Het probably null 0.614 07/07/2015
3 89459 APN 0610010F05Rik 0.174 IGL01522 G1 11 23582865 A G critical splice donor site 2 bp Het probably null 12/03/2013
4 396740 UTSW 0610010F05Rik 0.174 R5156 G1 225 Y 11 23593424 A G critical splice donor site 2 bp Het probably null 0.466 06/21/2016
5 227312 UTSW 1110017D15Rik 0.069 R2073 G1 225 N 4 41507519 A G critical splice donor site 2 bp Het probably null phenotype 09/17/2014
6 266808 UTSW 1500009L16Rik 0.060 R3416 G1 225 Y 10 83759632 T C critical splice donor site 2 bp Het probably null 0.494 02/18/2015
7 26834 APN 1500012F01Rik IGL00903 G1 2 167065486 G T critical splice donor site 6 bp Het probably benign 04/17/2013
8 547814 UTSW 1700001C19Rik 0.023 R7054 G1 225.01 N 17 47437189 A G critical splice donor site 2 bp Het probably null 05/13/2019
9 51166 APN 1700007G11Rik 0.178 IGL01133 G1 5 98498381 T C critical splice donor site 2 bp Het probably null 06/21/2013
10 29378 APN 1700010I14Rik 0.043 IGL00988 G1 17 8997105 T C critical splice donor site 2 bp Het probably null 04/17/2013
11 42078 UTSW 1700010I14Rik 0.043 R0482 G1 225 Y 17 8988423 T C critical splice donor site 2 bp Het probably null 0.522 05/23/2013
12 304149 APN 1700015F17Rik 0.182 IGL02701 5 5466623 A G critical splice donor site 2 bp Het probably null 04/16/2015
13 265174 UTSW 1700015F17Rik 0.182 R3056 G1 225 N 5 5457283 A T critical splice donor site 2 bp Het probably null 02/05/2015
14 542224 UTSW 1700017D01Rik 0.061 R6970 G1 225.01 N 19 11112314 A G critical splice donor site 2 bp Het probably null 11/28/2018
15 298525 APN 1700017N19Rik 0.044 IGL02556 10 100610717 T G critical splice donor site 2 bp Het probably null 04/16/2015
16 546548 UTSW 1700017N19Rik 0.044 R7034 G1 225.01 N 10 100609256 T A critical splice donor site 2 bp Het probably null 05/13/2019
17 546702 UTSW 1700017N19Rik 0.044 R7036 G1 225.01 N 10 100609256 T A critical splice donor site 2 bp Het probably null 05/13/2019
18 304113 APN 1700018B08Rik 0.046 IGL02700 8 121535422 C A critical splice donor site 1 bp Het probably null 04/16/2015
19 539586 UTSW 1700018B08Rik 0.046 R6920 G1 225.01 N 8 121535421 A G critical splice donor site 2 bp Het probably null 11/06/2018
20 311460 UTSW 1700021F07Rik 0.047 R4006 G1 225 N 2 173526087 T C critical splice donor site 2 bp Het probably null 04/29/2015
21 231555 UTSW 1700021P04Rik 0.065 R2087 G1 147 Y 19 24065000 T A critical splice donor site Het noncoding transcript 09/18/2014
22 104905 APN 1700030K09Rik 0.039 IGL01714 G1 8 72455569 T C critical splice donor site 2 bp Het probably null 01/21/2014
23 415371 APN 1700037H04Rik IGL03274 2 131153592 A T critical splice donor site 2 bp Het probably null 08/02/2016
24 512406 UTSW 1700061G19Rik 0.152 R6357 G1 170.01 N 17 56877591 T C critical splice donor site 2 bp Het probably null 04/27/2018
25 151721 UTSW 1700074P13Rik 0.028 R1250 G1 225 N 6 40925975 A T critical splice donor site 2 bp Het probably null 01/29/2014
26 440288 UTSW 1700123K08Rik 0.019 R5610 G1 225 N 5 138564141 A G critical splice donor site 2 bp Het probably null 11/08/2016
27 456485 UTSW 1810062G17Rik 0.099 R5905 G1 225 N 3 36479569 T A critical splice donor site 2 bp Het probably null 0.611 02/15/2017
28 480155 UTSW 1810062G17Rik 0.099 R6028 G1 225.01 Y 3 36479569 T A critical splice donor site 2 bp Het probably null 0.611 06/26/2017
29 234841 UTSW 1810065E05Rik 0.217 R2156 G1 225 N 11 58422308 T A critical splice donor site 2 bp Het probably null 10/01/2014
30 393810 UTSW 2010315B03Rik 0.088 R5110 G1 225 Y 9 124295357 C A critical splice donor site 1 bp Het probably null 0.638 06/15/2016
31 105226 APN 2200002D01Rik 0.089 IGL01724 G1 7 29247896 C T critical splice donor site 1 bp Het probably null 01/21/2014
32 374679 UTSW 2210407C18Rik 0.087 R4863 G1 225 Y 11 58612512 A T critical splice donor site 2 bp Het probably null 0.625 03/17/2016
33 407576 APN 2210408I21Rik 0.363 IGL03006 13 77323772 T C critical splice donor site 2 bp Het probably null 08/02/2016
34 326282 UTSW 2210408I21Rik 0.363 R4387 G1 225 N 13 77316574 T A critical splice donor site 2 bp Het probably null 0.428 07/06/2015
35 326316 UTSW 2210408I21Rik 0.363 R4388 G1 225 Y 13 77316574 T A critical splice donor site 2 bp Het probably null 0.428 07/06/2015
36 203614 UTSW 2310011J03Rik 0.054 R1808 G1 225 N 10 80320181 A G critical splice donor site 2 bp Het probably null 06/23/2014
37 506986 UTSW 2310035C23Rik 0.426 R6266 G1 225.01 N 1 105731282 T G critical splice donor site 2 bp Het probably null 03/15/2018
38 472880 UTSW 2310057J18Rik 0.075 R4801 G1 225 N 10 28983926 A G critical splice donor site 2 bp Het probably null 0.506 04/14/2017
39 370313 UTSW 2310057J18Rik 0.075 R4802 G1 225 Y 10 28983926 A G critical splice donor site 2 bp Het probably null 0.506 02/04/2016
40 436180 UTSW 2410004B18Rik 0.321 R5545 G1 225 N 3 145939098 T C critical splice donor site 2 bp Het probably null 10/24/2016
41 383621 UTSW 2610318N02Rik 0.087 R4948 G1 127 Y 16 17118290 A T critical splice donor site 2 bp Het probably null 0.656 04/27/2016
42 272395 UTSW 2610507B11Rik 0.960 R3788 G1 225 Y 11 78288297 T A critical splice donor site 2 bp Het probably null 0.468 03/25/2015
43 186200 UTSW 2610524H06Rik R1571 G1 220 N 5 114823311 A G critical splice donor site 2 bp Het probably null 05/09/2014
44 52457 APN 2700049A03Rik 1.000 IGL01107 G1 12 71194468 T C critical splice donor site 2 bp Het probably null phenotype 06/21/2013
45 33807 UTSW 2700049A03Rik 1.000 R0220 G1 140 N 12 71148420 T C critical splice donor site 2 bp Het probably null phenotype 05/09/2013
46 489804 UTSW 2810474O19Rik 0.000 R6160 G1 225.01 Y 6 149331507 G A critical splice donor site 1 bp Het probably null 10/10/2017
47 324513 UTSW 2900026A02Rik 0.074 R4329 G1 186 Y 5 113095589 C A critical splice donor site 1 bp Het probably null 0.574 06/24/2015
48 504531 UTSW 3110009E18Rik 0.048 R6229 G1 219.01 Y 1 120171483 G A critical splice donor site 1 bp Het probably null 02/28/2018
49 439494 UTSW 4430402I18Rik 0.104 R4911 G1 225 Y 19 28897503 G A critical splice donor site Het probably benign 0.068 11/02/2016
50 191138 UTSW 4732465J04Rik 0.240 R1717 G1 148 Y 10 95793779 GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT GATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCTATCT critical splice donor site Het probably null 05/14/2014
51 89778 APN 4833420G17Rik 0.157 IGL01531 G1 13 119466958 T A critical splice donor site 2 bp Het probably null 12/03/2013
52 249919 UTSW 4833427G06Rik 0.107 R2444 G1 225 N 9 51099998 A G critical splice donor site 2 bp Het probably null 11/12/2014
53 153057 APN 4833439L19Rik 0.235 IGL01747 G1 13 54556525 A G critical splice donor site 2 bp Het probably null 02/04/2014
54 161756 UTSW 4921504E06Rik 0.031 R1456 G1 225 Y 2 19480920 C T critical splice donor site 1 bp Het probably null 0.602 03/14/2014
55 432623 UTSW 4921507P07Rik 0.117 R5453 G1 225 N 6 50595796 A G critical splice donor site 2 bp Het probably null 10/06/2016
56 527886 UTSW 4921507P07Rik 0.117 R6689 G1 225.01 N 6 50589109 A G critical splice donor site 2 bp Het probably null 07/23/2018
57 274885 UTSW 4921524L21Rik 0.104 R3820 G1 225 Y 18 6630166 G T critical splice donor site 1 bp Het probably null 0.530 04/02/2015
58 455349 UTSW 4921524L21Rik 0.104 R5873 G1 225 N 18 6630167 T A critical splice donor site 2 bp Het probably null 02/10/2017
59 525369 UTSW 4921539E11Rik 0.013 R6634 G1 225.01 Y 4 103236930 C T critical splice donor site 1 bp Het probably null 0.554 06/22/2018
60 50633 APN 4930402H24Rik 0.144 IGL01146 G1 2 130770671 C T critical splice donor site 1 bp Het probably null phenotype 06/21/2013
61 163374 UTSW 4930402H24Rik 0.144 R1485 G1 211 N 2 130748683 A G critical splice donor site 2 bp Het probably null phenotype 03/28/2014
62 530095 UTSW 4930402H24Rik 0.144 R6732 G1 225.01 Y 2 130810820 A G critical splice donor site 2 bp Het probably null 0.700 phenotype 08/01/2018
63 297010 APN 4930415O20Rik 0.163 IGL02524 15 98571125 G A critical splice donor site 1 bp Het probably null 04/16/2015
64 57037 UTSW 4930430A15Rik 0.040 R0645 G1 159 Y 2 111214583 C T critical splice donor site 1 bp Het probably null 0.610 07/11/2013
65 200914 UTSW 4930430A15Rik 0.040 R1464 G1 225 N 2 111225403 A G critical splice donor site 2 bp Het probably null 05/23/2014
66 512672 UTSW 4930430A15Rik 0.040 R6366 G1 225.01 N 2 111169592 A G critical splice donor site 2 bp Het probably null 0.601 04/27/2018
67 542764 UTSW 4930430A15Rik 0.040 R6983 G1 225.01 N 2 111228250 A G critical splice donor site 2 bp Het probably null 11/28/2018
68 389692 UTSW 4930444P10Rik 0.091 R4999 G1 225 N 1 16068798 A G critical splice donor site 2 bp Het probably null 06/06/2016
69 401005 UTSW 4930447C04Rik 0.355 R5243 G1 225 Y 12 72909769 A T critical splice donor site 2 bp Het probably null 0.474 phenotype 07/06/2016
70 432728 UTSW 4930452B06Rik 0.097 R5455 G1 225 N 14 8536516 A T critical splice donor site 2 bp Het probably null 10/06/2016
71 288146 APN 4930467E23Rik IGL02318 8 19747799 T C critical splice donor site 2 bp Het probably null 04/16/2015
72 251724 UTSW 4930510E17Rik 0.163 R2847 G1 225 N 9 53264789 T C critical splice donor site Het noncoding transcript 12/04/2014
73 162048 UTSW 4930522H14Rik 0.029 R1460 G1 225 Y 4 109531210 A T critical splice donor site 2 bp Het probably null 0.520 03/14/2014
74 382049 UTSW 4930522L14Rik 0.107 R4952 G1 225 Y 5 109739197 A G critical splice donor site 2 bp Het probably null 0.611 04/27/2016
75 396515 UTSW 4930522L14Rik 0.107 R5143 G1 212 N 5 109739198 C T critical splice donor site 1 bp Het probably null 06/21/2016
76 501380 UTSW 4930579C12Rik 0.131 R5756 G1 133 Y 9 89128866 A G critical splice donor site Het noncoding transcript 0.060 12/01/2017
77 234249 UTSW 4930579F01Rik 0.055 R2151 G1 225 Y 3 138176456 A G critical splice donor site 2 bp Het probably null 0.546 10/01/2014
78 54554 UTSW 4930596D02Rik 0.251 R0609 G1 225 N 14 35811461 A T critical splice donor site 2 bp Het probably null 07/11/2013
79 516839 UTSW 4931406P16Rik 0.269 R6477 G1 225.01 Y 7 34257630 A G critical splice donor site 2 bp Het probably null 05/21/2018
80 267531 UTSW 4931409K22Rik 0.158 R3522 G1 225 Y 5 24549626 A G critical splice donor site 2 bp Het probably null 0.631 02/18/2015
81 367659 UTSW 4931409K22Rik 0.158 R4773 G1 225 Y 5 24550598 A G critical splice donor site 2 bp Het probably null 0.580 12/29/2015
82 326435 UTSW 4931414P19Rik 0.082 R4392 G1 225 Y 14 54584978 C T critical splice donor site 1 bp Het probably null 0.660 07/06/2015
83 439685 UTSW 4931423N10Rik 0.066 R5619 G1 225 Y 2 23257005 T C critical splice donor site 2 bp Het probably null 0.632 11/08/2016
84 396289 UTSW 4931429L15Rik 0.219 R5138 G1 225 Y 9 46306821 C A critical splice donor site 1 bp Het probably null 0.630 06/21/2016
85 427931 UTSW 4931429L15Rik 0.219 R5419 G1 225 N 9 46309326 C T critical splice donor site 1 bp Het probably null 09/01/2016
86 307848 UTSW 4932414N04Rik 0.070 R3950 G1 225 N 2 68664403 T C critical splice donor site 2 bp Het probably null 0.610 04/17/2015
87 307917 UTSW 4932414N04Rik 0.070 R3951 G1 225 Y 2 68664403 T C critical splice donor site 2 bp Het probably null 0.610 04/17/2015
88 307973 UTSW 4932414N04Rik 0.070 R3952 G1 225 Y 2 68664403 T C critical splice donor site 2 bp Het probably null 0.610 04/17/2015
89 78785 APN 4932438A13Rik 0.882 IGL01377 G1 3 36973452 T C critical splice donor site 2 bp Het probably null phenotype 11/05/2013
90 286293 APN 4932438A13Rik 0.882 IGL02248 3 36969290 T C critical splice donor site 2 bp Het probably null phenotype 04/16/2015
91 222613 UTSW 4932438A13Rik 0.882 R1987 G1 225 N 3 36953985 T A critical splice donor site 2 bp Het probably null phenotype 08/25/2014
92 241406 UTSW 4932438A13Rik 0.882 R2220 G1 225 N 3 36875530 T C critical splice donor site 2 bp Het probably null phenotype 10/15/2014
93 545793 UTSW 4933427D14Rik 0.193 R7023 G1 225.01 N 11 72178403 A G critical splice donor site 2 bp Het probably null 05/13/2019
94 378756 UTSW 5330417C22Rik 0.159 R4923 G1 225 Y 3 108471968 C T critical splice donor site 1 bp Het probably null 0.674 phenotype 04/15/2016
95 527136 UTSW 5430401F13Rik 0.040 R6671 G1 225.01 Y 6 131551350 T C critical splice donor site 2 bp Het probably null 07/23/2018
96 297896 APN 5430403G16Rik 0.117 IGL02547 5 109678762 C T critical splice donor site 1 bp Het probably null 04/16/2015
97 418431 APN 5430419D17Rik 0.039 IGL03092 7 131201798 G T critical splice donor site 1 bp Het probably null 08/02/2016
98 267317 UTSW 5430419D17Rik 0.039 R3439 G1 225 Y 7 131188779 T C critical splice donor site 2 bp Het probably null 0.637 02/18/2015
99 510346 UTSW 5430419D17Rik 0.039 R6321 G1 225.01 Y 7 131257006 T C critical splice donor site 2 bp Het probably null 04/02/2018
100 518590 UTSW 5430419D17Rik 0.039 R6432 G1 225.01 Y 7 131244872 G A critical splice donor site 1 bp Het probably null 05/24/2018
[records 1 to 100 of 9846] next >> last >|