Incidental Mutations

426,400 incidental mutations are currently displayed, and affect 22,218 genes.
65,985 are Possibly Damaging.
155,183 are Probably Damaging.
147,013 are Probably Benign.
44,760 are Probably Null.
17,476 create premature stop codons.
12,049 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 426400] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 554318 UTSW Ccdc122 0.207 R6833 G1 225.01 Y 14 77088931 G T critical splice acceptor site Het probably benign 05/20/2019
2 554317 UTSW Ak9 0.184 R6847 G1 62.01 Y 10 41357801 A G intron 143 bp Het probably null phenotype 05/20/2019
3 554316 UTSW Svil 0.368 R6916 G1 225.01 Y 18 5114682 G A utr 3 prime Het probably benign phenotype 05/20/2019
4 554315 UTSW Ciita 0.204 R6916 G1 150.01 Y 16 10509207 T A intron Het probably null phenotype 05/20/2019
5 554314 UTSW Mbd5 1.000 R6935 G1 225.01 Y 2 49279812 Y113C A G missense Het probably damaging 0.974 phenotype 05/20/2019
6 554313 UTSW Vstm4 0.082 R6927 G1 225.01 Y 14 32864002 T A intron 71 bp Het probably null 05/20/2019
7 554312 UTSW Prl2c5 0.351 R6927 G1 225.01 Y 13 13182918 A T intron 106 bp Het probably null 05/20/2019
8 554311 UTSW Plekhb2 0.060 R6927 G1 222.01 Y 1 34876901 T A splice site Het probably null 05/20/2019
9 554310 UTSW Dmtf1 0.452 R6921 G1 225.01 Y 5 9130654 T C intron Het probably benign phenotype 05/20/2019
10 554309 UTSW Smok2a 0.089 R6912 G1 63.01 Y 17 13225656 T40K C A missense Het probably benign 0.080 05/20/2019
11 554308 UTSW Syne2 0.317 R6899 G1 116.01 Y 12 76095729 A G intron 55 bp Het probably null phenotype 05/20/2019
12 554307 UTSW Ces2b 0.025 R6899 G1 225.01 Y 8 104836766 T A splice site Het probably null 05/20/2019
13 554306 UTSW Sod3 0.000 R6899 G1 73.01 Y 5 52368708 T250A A G missense Het unknown phenotype 05/20/2019
14 554305 UTSW Slit3 0.819 R6887 G1 54.01 Y 11 35544806 T C splice site 6 bp Het probably null phenotype 05/20/2019
15 554304 UTSW Slc2a2 1.000 R6932 G1 225.01 Y 3 28717519 S158P T C missense Het probably benign 0.399 phenotype 05/17/2019
16 554303 UTSW 2210011C24Rik R6918 G1 42.01 Y 8 84011684 M1L T G start codon destroyed Het probably benign 0.008 05/17/2019
17 554302 UTSW Dyrk1b 0.418 R6918 G1 77.01 Y 7 28185925 D396G A G missense Het probably damaging 0.993 phenotype 05/17/2019
18 554301 UTSW Eno1b 0.968 R6917 G1 75.01 Y 18 48047589 D278G A G missense Het probably benign 0.000 0.101 phenotype 05/17/2019
19 554300 UTSW Abi3bp 0.138 R6917 G1 225.01 Y 16 56617321 A G intron Het probably null 05/17/2019
20 554299 UTSW Zfp445 0.502 R6917 G1 50.01 Y 9 122862294 A T intron Het probably null 05/17/2019
21 554298 UTSW Rtel1 1.000 R6917 G1 217.47 Y 2 181338277 ATT ATTTT makesense Het probably null phenotype 05/17/2019
22 554297 UTSW Tjp2 1.000 R7153 G1 225.01 N 19 24101981 N843K A T missense Het not run phenotype 05/15/2019
23 554296 UTSW Plcb3 0.300 R7153 G1 225.01 N 19 6958084 A G critical splice donor site Het unknown phenotype 05/15/2019
24 554295 UTSW Pcdhga2 0.166 R7153 G1 225.01 N 18 37669208 V35A T C missense Het not run phenotype 05/15/2019
25 554294 UTSW Pcdha11 0.164 R7153 G1 225.01 N 18 37011225 V123A T C missense Het not run phenotype 05/15/2019
26 554293 UTSW Npc1 0.254 R7153 G1 225.01 N 18 12213291 F283L A G missense Het not run phenotype 05/15/2019
27 554292 UTSW Prkd3 0.240 R7153 G1 225.01 N 17 78966355 D491N C T missense Het not run phenotype 05/15/2019
28 554291 UTSW Nlrc4 0.140 R7153 G1 225.01 N 17 74447103 E95G T C missense Het not run phenotype 05/15/2019
29 554290 UTSW Fbxl17 0.295 R7153 G1 225.01 N 17 63060351 V676F C A missense Het not run phenotype 05/15/2019
30 554289 UTSW Rpl36 R7153 G1 225.01 N 17 56614137 I81T T C missense Het not run 05/15/2019
31 554288 UTSW Slc29a1 0.000 R7153 G1 225.01 N 17 45585762 A429V G A missense Het not run phenotype 05/15/2019
32 554287 UTSW Tff1 0.000 R7153 G1 225.01 N 17 31162798 I35T A G missense Het not run phenotype 05/15/2019
33 554286 UTSW Axin1 1.000 R7153 G1 225.01 N 17 26187968 T512A A G missense Het not run phenotype 05/15/2019
34 554285 UTSW Fndc1 0.115 R7153 G1 225.01 N 17 7801645 V102A A G missense Het not run 05/15/2019
35 554284 UTSW Lca5l 0.112 R7153 G1 225.01 N 16 96173809 N305I T A missense Het not run 05/15/2019
36 554283 UTSW Synj1 1.000 R7153 G1 225.01 N 16 90948090 G1189R C T missense Het not run phenotype 05/15/2019
37 554282 UTSW Bcl6 0.858 R7153 G1 225.01 N 16 23966226 R675* G A nonsense Het probably null phenotype 05/15/2019
38 554281 UTSW Ehhadh 0.000 R7153 G1 225.01 N 16 21766321 F270S A G missense Het not run phenotype 05/15/2019
39 554280 UTSW Krt77 0.103 R7153 G1 225.01 N 15 101865496 T241M G A missense Het not run phenotype 05/15/2019
40 554279 UTSW Arhgap39 0.161 R7153 G1 225.01 N 15 76765491 S27I C A missense Het not run 05/15/2019
41 554278 UTSW Gpalpp1 R7153 G1 218.01 N 14 76095011 Y273C T C missense Het not run 05/15/2019
42 554277 UTSW Zmym2 0.859 R7153 G1 225.01 N 14 56950202 D1108E T A missense Het not run phenotype 05/15/2019
43 554276 UTSW Mmp14 0.872 R7153 G1 225.01 N 14 54436251 I124T T C missense Het not run phenotype 05/15/2019
44 554275 UTSW Trav12-3 R7153 G1 225.01 N 14 53622161 L88P T C missense Het not run 05/15/2019
45 554274 UTSW Stab1 0.000 R7153 G1 225.01 N 14 31160584 E432A T G missense Het not run phenotype 05/15/2019
46 554273 UTSW Esyt2 0.238 R7153 G1 225.01 N 12 116346508 M397V A G missense Het not run phenotype 05/15/2019
47 554272 UTSW Ighv15-2 0.106 R7153 G1 225.01 N 12 114564590 Y114* G T nonsense Het probably null 05/15/2019
48 554271 UTSW Ttc7b 0.655 R7153 G1 225.01 N 12 100355034 W613R A T missense Het not run 05/15/2019
49 554270 UTSW Gpatch8 0.492 R7153 G1 217.47 N 11 102480188 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC Het phenotype 05/15/2019
50 554269 UTSW Krt36 0.110 R7153 G1 225.01 N 11 100105146 Q151* G A nonsense Het probably null phenotype 05/15/2019
51 554268 UTSW Tenm2 0.000 R7153 G1 225.01 N 11 36024182 V2176A A G missense Het not run phenotype 05/15/2019
52 554267 UTSW Cobl 0.000 R7153 G1 225.01 N 11 12254128 P858Q G T missense Het not run phenotype 05/15/2019
53 554266 UTSW Grik2 0.000 R7153 G1 225.01 N 10 49535367 H225R T C missense Het not run phenotype 05/15/2019
54 554265 UTSW Crybg1 0.169 R7153 G1 225.01 N 10 43964666 Y1812F T A missense Het not run 05/15/2019
55 554264 UTSW Tbc1d21 0.217 R7153 G1 225.01 N 9 58363093 D133G T C missense Het not run 05/15/2019
56 554263 UTSW Tmem225 0.054 R7153 G1 225.01 N 9 40148368 F15L T C missense Het not run 05/15/2019
57 554262 UTSW Fanca 0.721 R7153 G1 225.01 N 8 123316425 L74H A T missense Het not run phenotype 05/15/2019
58 554261 UTSW Pkd1l3 0.000 R7153 G1 214.46 N 8 109624195 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA small deletion Het probably benign phenotype 05/15/2019
59 554260 UTSW Ddx60 0.135 R7153 G1 225.01 N 8 61988108 K1070N A T missense Het not run phenotype 05/15/2019
60 554259 UTSW Tubgcp2 0.970 R7153 G1 225.01 N 7 140001036 H668R T C missense Het not run 05/15/2019
61 554258 UTSW Pik3c2a 0.824 R7153 G1 225.01 N 7 116342252 N1593S T C missense Het not run phenotype 05/15/2019
62 554257 UTSW Timm10b 0.158 R7153 G1 225.01 N 7 105640880 Q50R A G missense Het not run phenotype 05/15/2019
63 554256 UTSW Vmn2r70 0.153 R7153 G1 225.01 N 7 85565054 S297P A G missense Het probably damaging 0.999 0.028 05/15/2019
64 554255 UTSW AU018091 0.213 R7153 G1 225.01 N 7 3159513 M296L T A missense Het not run 05/15/2019
65 554254 UTSW C2cd5 0.395 R7153 G1 225.01 N 6 143019409 S871P A G missense Het not run 05/15/2019
66 554253 UTSW Ano2 0.212 R7153 G1 225.01 N 6 125992943 T741A A G missense Het not run phenotype 05/15/2019
67 554252 UTSW B4galnt3 0.060 R7153 G1 225.01 N 6 120214968 D602E A T missense Het not run phenotype 05/15/2019
68 554251 UTSW Irak2 0.000 R7153 G1 225.01 N 6 113678709 H357R A G missense Het not run phenotype 05/15/2019
69 554250 UTSW Vmn1r14 0.163 R7153 G1 225.01 N 6 57233866 S143F C T missense Het not run 05/15/2019
70 554249 UTSW Kcp 0.162 R7153 G1 225.01 N 6 29499015 E320G T C missense Het not run phenotype 05/15/2019
71 554248 UTSW Pgd 0.974 R7153 G1 225.01 N 4 149161678 T94K G T missense Het not run phenotype 05/15/2019
72 554247 UTSW Ptprf 0.690 R7153 G1 225.01 N 4 118231543 T688A T C missense Het not run phenotype 05/15/2019
73 554246 UTSW Bsnd 0.031 R7153 G1 225.01 N 4 106492033 D3E A T missense Het not run phenotype 05/15/2019
74 554245 UTSW Rraga 1.000 R7153 G1 225.01 N 4 86576016 A33V C T missense Het not run phenotype 05/15/2019
75 554244 UTSW Tle1 0.765 R7153 G1 225.01 N 4 72139061 F101I A T missense Het not run 05/15/2019
76 554243 UTSW Synpo2 0.128 R7153 G1 225.01 N 3 123112404 *1088Q A G makesense Het not run 05/15/2019
77 554242 UTSW Kpna4 0.000 R7153 G1 225.01 N 3 69089798 L352S A G missense Het not run phenotype 05/15/2019
78 554241 UTSW Helz2 0.000 R7153 G1 225.01 N 2 181231285 S2411T A T missense Het not run phenotype 05/15/2019
79 554240 UTSW Ywhab 0.418 R7153 G1 225.01 N 2 164014060 F119L T C missense Het not run phenotype 05/15/2019
80 554239 UTSW Defb22 0.276 R7153 G1 225.01 N 2 152485920 K115R T C missense Het not run 05/15/2019
81 554238 UTSW Mertk 0.295 R7153 G1 225.01 N 2 128736649 Y185C A G missense Het not run phenotype 05/15/2019
82 554237 UTSW Olfr1282 0.206 R7153 G1 225.01 N 2 111335901 M59K A T missense Het not run phenotype 05/15/2019
83 554236 UTSW Olfr1180 R7153 G1 225.01 N 2 88412118 L180W A C missense Het not run phenotype 05/15/2019
84 554235 UTSW Btbd18 0.229 R7153 G1 225.01 N 2 84666428 R137* C T nonsense Het probably null phenotype 05/15/2019
85 554234 UTSW Ttn 1.000 R7153 G1 225.01 N 2 76945316 D1840G T C missense Het not run phenotype 05/15/2019
86 554233 UTSW Ttn 1.000 R7153 G1 225.01 N 2 76778504 M17723L T A missense Het not run phenotype 05/15/2019
87 554232 UTSW Crb2 1.000 R7153 G1 225.01 N 2 37787408 H304L A T missense Het not run phenotype 05/15/2019
88 554231 UTSW Hnmt 0.138 R7153 G1 225.01 N 2 24014341 A103T C T missense Het not run phenotype 05/15/2019
89 554230 UTSW Thnsl1 0.099 R7153 G1 225.01 N 2 21212953 V506A T C missense Het not run 05/15/2019
90 554229 UTSW Ush2a 0.491 R7153 G1 225.01 N 1 188728484 N2647K C A missense Het not run phenotype 05/15/2019
91 554228 UTSW Lefty1 1.000 R7153 G1 225.01 N 1 180937767 L300Q T A missense Het not run phenotype 05/15/2019
92 554227 UTSW Pycr2 0.100 R7153 G1 225.01 N 1 180906682 L210M T A missense Het not run phenotype 05/15/2019
93 554226 UTSW Aox4 0.000 R7153 G1 225.01 N 1 58250219 M767T T C missense Het not run phenotype 05/15/2019
94 554225 UTSW Dnah7b 0.270 R7153 G1 225.01 N 1 46126804 F543Y T A missense Het not run 05/15/2019
95 554224 UTSW March3 R7152 G1 225.01 N 18 56775981 V244A A G missense Het probably benign 0.006 phenotype 05/15/2019
96 554223 UTSW Pcdhgb1 0.162 R7152 G1 225.01 N 18 37681801 H448Q C A missense Het not run phenotype 05/15/2019
97 554222 UTSW Ltn1 1.000 R7152 G1 225.01 N 16 87427641 F65S A G missense Het not run phenotype 05/15/2019
98 554221 UTSW Ddx17 1.000 R7152 G1 225.01 N 15 79530263 T570A T C missense Het not run phenotype 05/15/2019
99 554220 UTSW Cgrrf1 0.296 R7152 G1 225.01 N 14 46853477 Y223* T A nonsense Het probably null 05/15/2019
100 554219 UTSW BC067074 0.347 R7152 G1 225.01 N 13 113318850 F477L T C missense Het not run 05/15/2019
[records 1 to 100 of 426400] next >> last >|