Incidental Mutations

440,494 incidental mutations are currently displayed, and affect 22,269 genes.
69,165 are Possibly Damaging.
161,869 are Probably Damaging.
153,573 are Probably Benign.
46,375 are Probably Null.
18,140 create premature stop codons.
12,461 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 440494] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 561124 UTSW 4932438A13Rik 0.882 R7212 G1 225.01 N 3 37048009 N1363K C A missense Het phenotype 06/26/2019
2 562963 UTSW 4933402N22Rik R7238 G1 191.01 N 5 11920745 I127T T C missense Het 06/26/2019
3 561113 UTSW 9930021J03Rik 0.245 R7211 G1 225.01 N 19 29786312 F121S A G missense Het 06/26/2019
4 558061 UTSW Abcb10 1.000 R7168 G1 225.01 N 8 123966611 L318Q A T missense Het phenotype 06/26/2019
5 543419 UTSW Abcc12 0.105 R6518 G1 225.01 Y 8 86509089 A G Het phenotype 11/29/2018
6 561733 UTSW Acan 1.000 R7220 G1 225.01 N 7 79108148 N506S A G missense Het phenotype 06/26/2019
7 551390 UTSW Adamtsl3 0.142 R7109 G1 225.01 N 7 82611861 P29S C T missense Het phenotype 05/15/2019
8 561309 UTSW Adgrg5 0.191 R7214 G1 225.01 N 8 94934018 T95I C T missense Het phenotype 06/26/2019
9 554671 UTSW Adgrl2 1.000 PIT4382001 G1 225.01 N 3 148817298 L430P A G missense Het phenotype 06/07/2019
10 553830 UTSW Adk 1.000 R7146 G1 225.01 N 14 21326614 P27H C A missense Het phenotype 05/15/2019
11 555381 UTSW Agl 0.250 PIT4445001 G1 225.01 N 3 116771460 M382V T C missense Het phenotype 06/07/2019
12 556869 UTSW Ahnak2 0.055 PIT4810001 G1 225.01 N 12 112785594 D211V T A missense Het 06/07/2019
13 548980 UTSW Ahnak2 0.055 R7072 G1 225.01 N 12 112788166 Q23L T A missense Het 05/15/2019
14 551581 UTSW Ahnak2 0.055 R7112 G1 131.01 N 12 112783119 A1036E G T missense Het 05/15/2019
15 565099 UTSW Ahnak2 0.055 R7268 G1 203.01 N 12 112780802 V70E A T missense Het 06/26/2019
16 565173 UTSW Ahnak2 0.055 R7269 G1 225.01 N 12 112780802 V70E A T missense Het 06/26/2019
17 565251 UTSW Ahnak2 0.055 R7270 G1 216.01 N 12 112780802 V70E A T missense Het 06/26/2019
18 565315 UTSW Ahnak2 0.055 R7271 G1 225.01 N 12 112780802 V70E A T missense Het 06/26/2019
19 566021 UTSW Ak9 0.181 R7286 G1 225.01 N 10 41407371 I1273L A T missense Het phenotype 06/26/2019
20 547457 UTSW Akap11 0.000 R7048 G1 225.01 Y 14 78512514 Q811L T A missense Het phenotype 05/13/2019
21 553905 UTSW Akap11 0.000 R7147 G1 225.01 N 14 78511465 S1161P A G missense Het phenotype 05/15/2019
22 555969 UTSW Ank3 0.871 PIT4495001 G1 222.01 N 10 69993072 H2524N C A missense Het phenotype 06/07/2019
23 552757 UTSW Ank3 0.871 R7132 G1 225.01 N 10 69989914 A1471V C T missense Het phenotype 05/15/2019
24 558280 UTSW Ank3 0.871 R7171 G1 225.01 N 10 69992481 H2327Y C T missense Het phenotype 06/26/2019
25 549191 UTSW Ankhd1 0.341 R7075 G1 225.01 Y 18 36559989 V1A T C missense Het 05/15/2019
26 567280 UTSW Ankhd1 0.341 R7305 G1 225.01 N 18 36632205 D87G A G missense Het 06/26/2019
27 558731 UTSW Ankrd44 0.247 R7178 G1 225.01 N 1 54649440 N212K A T missense Het 06/26/2019
28 560123 UTSW Ano7 0.314 R7199 G1 225.01 N 1 93402978 D54V A T missense Het phenotype 06/26/2019
29 566104 UTSW Arhgap32 0.000 R7287 G1 225.01 N 9 32152697 D77G A G missense Het phenotype 06/26/2019
30 554609 UTSW Arhgef38 0.227 PIT4362001 G1 225.01 N 3 133160830 D182V T A missense Het 06/07/2019
31 559285 UTSW Arid1a 1.000 R7186 G1 107.47 N 4 133753233 TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG Het phenotype 06/26/2019
32 555389 UTSW Atp8a1 0.000 PIT4445001 G1 149.01 N 5 67622660 V1145A A G missense Het phenotype 06/07/2019
33 561580 UTSW Atp8a1 0.000 R7218 G1 225.01 N 5 67702981 D717V T A missense Het phenotype 06/26/2019
34 565277 UTSW Atp9a 0.504 R7271 G1 225.01 N 2 168734127 G A Het 06/26/2019
35 552872 UTSW Atp9b 0.194 R7133 G1 225.01 N 18 80909656 V164A A G missense Het 05/15/2019
36 559460 UTSW Atp9b 0.194 R7188 G1 225.01 N 18 80917826 S57P A G missense Het 06/26/2019
37 557139 UTSW Auts2 0.423 R7154 G1 225.01 N 5 131451893 S255T A T missense Het phenotype 06/26/2019
38 551714 UTSW Axdnd1 0.162 R7115 G1 225.01 N 1 156380876 K267R T C missense Het phenotype 05/15/2019
39 551814 UTSW Baz2b 0.431 R7117 G1 225.01 N 2 59912497 V13A A G missense Het phenotype 05/15/2019
40 552523 UTSW BC051019 0.218 R7129 G1 225.01 N 7 109720618 S10G T C missense Het 05/15/2019
41 550784 UTSW BC067074 0.347 R7100 G1 225.01 N 13 113318967 F516I T A missense Het 05/15/2019
42 551740 UTSW BC067074 0.347 R7115 G1 225.01 N 13 113320776 S1119A T G missense Het 05/15/2019
43 554219 UTSW BC067074 0.347 R7152 G1 225.01 N 13 113318850 F477L T C missense Het 05/15/2019
44 559880 UTSW BC067074 0.347 R7195 G1 225.01 N 13 113367929 D1864V A T missense Het 06/26/2019
45 561243 UTSW BC067074 0.347 R7213 G1 225.01 N 13 113317941 F174I T A missense Het 06/26/2019
46 563869 UTSW BC067074 0.347 R7250 G1 225.01 N 13 113318815 I465R T G missense Het 06/26/2019
47 564571 UTSW Boc 0.000 R7260 G1 225.01 N 16 44490170 F796I A T missense Het phenotype 06/26/2019
48 550006 UTSW C2cd3 1.000 R7088 G1 225.01 N 7 100416181 T347A A G missense Het phenotype 05/15/2019
49 558493 UTSW C2cd3 1.000 R7174 G1 225.01 N 7 100432198 S1016P T C missense Het phenotype 06/26/2019
50 563204 UTSW C2cd3 1.000 R7241 G1 225.01 N 7 100407050 K177T A C missense Het phenotype 06/26/2019
51 564881 UTSW Cabin1 1.000 R7265 G1 225.01 N 10 75721423 N300S T C missense Het phenotype 06/26/2019
52 565878 UTSW Cabin1 1.000 R7284 G1 225.01 N 10 75694834 R178C G A missense Het phenotype 06/26/2019
53 555581 UTSW Cacna1c 0.788 PIT4418001 G1 220.01 N 6 118654423 E1155G T C missense Het phenotype 06/07/2019
54 548953 UTSW Cacna1c 0.788 R7072 G1 225.01 N 6 118596106 V2039A A G missense Het phenotype 05/15/2019
55 559652 UTSW Cacna1c 0.788 R7192 G1 225.01 N 6 118656249 I1099V T C missense Het phenotype 06/26/2019
56 563826 UTSW Cacna1c 0.788 R7250 G1 225.01 N 6 118598005 C1985R A G missense Het phenotype 06/26/2019
57 563827 UTSW Cacna1c 0.788 R7250 G1 225.01 N 6 118696451 V647E A T missense Het phenotype 06/26/2019
58 564813 UTSW Cacna1c 0.788 R7264 G1 225.01 N 6 118602195 N1847S T C missense Het phenotype 06/26/2019
59 567664 UTSW Cacna1c 0.788 R7312 G1 225.01 N 6 119057211 I118M T C missense Het phenotype 06/26/2019
60 553868 UTSW Cald1 1.000 R7147 G1 225.01 N 6 34746296 Q105L A T missense Het phenotype 05/15/2019
61 554734 UTSW Camsap2 0.555 PIT4366001 G1 133.01 N 1 136280317 F478L A G missense Het 06/07/2019
62 531241 UTSW Ccdc171 0.217 PIT4131001 G1 50 Y 4 83661709 C T Het phenotype 08/10/2018
63 551489 UTSW Cdh7 0.146 R7111 G1 225.01 N 1 110137908 S176P T C missense Het phenotype 05/15/2019
64 554055 UTSW Ceacam3 0.000 R7150 G1 225.01 N 7 17151562 Q30R A G missense Het 05/15/2019
65 559922 UTSW Ceacam3 0.000 R7196 G1 225.01 N 7 17154956 Y217H T C missense Het 06/26/2019
66 565727 UTSW Cecr2 0.538 R7282 G1 225.01 N 6 120761621 N325I A T missense Het phenotype 06/26/2019
67 550352 UTSW Cfap100 0.042 R7094 G1 225.01 N 6 90413454 E68G T C missense Het 05/15/2019
68 556670 UTSW Cfap46 0.060 PIT4651001 G1 211.01 N 7 139645551 T1078A T C missense Het 06/07/2019
69 553590 UTSW Cflar 1.000 R7144 G1 225.01 N 1 58753848 V458F G T missense Het phenotype 05/15/2019
70 560585 UTSW Cflar 1.000 R7206 G1 225.01 N 1 58740991 M248I G T missense Het phenotype 06/26/2019
71 553715 UTSW Cherp 0.949 R7145 G1 225.01 N 8 72468386 K270E T C missense Het 05/15/2019
72 562826 UTSW Ciapin1 1.000 R7236 G1 225.01 N 8 94823710 T34A T C missense Het phenotype 06/26/2019
73 550114 UTSW Clcn7 1.000 R7089 G1 225.01 N 17 25153693 H149Y C T missense Het phenotype 05/15/2019
74 562969 UTSW Clip1 0.000 R7238 G1 225.01 N 5 123613265 E818K C T missense Het phenotype 06/26/2019
75 565787 UTSW Clip1 0.000 R7283 G1 225.01 N 5 123613794 C641W A C missense Het phenotype 06/26/2019
76 540722 UTSW Cmtm1 0.400 R6821 G1 214.46 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
77 540724 UTSW Cmtm1 0.400 R6822 G1 168.47 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
78 550718 UTSW Cobl 0.000 R7099 G1 225.01 N 11 12296540 H154L T A missense Het phenotype 05/15/2019
79 552645 UTSW Crhr2 0.266 R7131 G1 225.01 N 6 55092127 N388D T C missense Het phenotype 05/15/2019
80 545495 UTSW Csmd2 0.375 R7019 G1 225.01 N 4 128369063 D681N G A missense Het 05/13/2019
81 546113 UTSW Csmd2 0.375 R7028 G1 225.01 N 4 128277228 N338S A G missense Het 05/13/2019
82 550472 UTSW Csmd2 0.375 R7096 G1 225.01 N 4 128462726 S1608L C T missense Het 05/15/2019
83 552059 UTSW Csmd2 0.375 R7122 G1 225.01 N 4 128449227 V1471M G A missense Het 05/15/2019
84 552260 UTSW Csmd2 0.375 R7125 G1 225.01 N 4 128496162 L2230P T C missense Het 05/15/2019
85 559999 UTSW Csmd2 0.375 R7197 G1 225.01 N 4 128511033 Y2404C A G missense Het 06/26/2019
86 562685 UTSW Csmd2 0.375 R7234 G1 225.01 N 4 128456779 Y1547C A G missense Het 06/26/2019
87 566847 UTSW Csmd2 0.375 R7299 G1 225.01 N 4 128528262 D2797E C A missense Het 06/26/2019
88 566965 UTSW Csmd2 0.375 R7301 G1 225.01 N 4 128528262 D2797E C A missense Het 06/26/2019
89 568043 UTSW Csmd2 0.375 R7319 G1 225.01 N 4 128393679 Y1069F A T missense Het 06/26/2019
90 558789 UTSW Csmd3 0.848 R7178 G1 225.01 N 15 47590774 I2648F T A missense Het 06/26/2019
91 559684 UTSW Csmd3 0.848 R7192 G1 225.01 N 15 47704237 V1266I C T missense Het 06/26/2019
92 558128 UTSW Csnk2a2 0.491 R7169 G1 97.01 N 8 95488378 Y24H A G missense Het phenotype 06/26/2019
93 548989 UTSW D730001G18Rik R7072 G1 225.01 N 15 74772270 V66M C T missense Het 05/15/2019
94 567220 UTSW Dab1 0.635 R7305 G1 225.01 N 4 104713790 D210E T A missense Het phenotype 06/26/2019
95 562783 UTSW Dcdc2c 0.060 R7235 G1 225.01 N 12 28470719 S453P A G missense Het 06/26/2019
96 548434 UTSW Decr1 0.320 R7064 G1 225.01 N 4 15945392 C A Het phenotype 05/13/2019
97 555553 UTSW Dennd1b 0.174 PIT4418001 G1 225.01 N 1 139081261 L159P T C missense Het phenotype 06/07/2019
98 559073 UTSW Dlg5 1.000 R7182 G1 225.01 N 14 24244856 V3A A G missense Het phenotype 06/26/2019
99 551711 UTSW Dnajb2 0.387 R7115 G1 225.01 N 1 75243662 G275D G A missense Het phenotype 05/15/2019
100 549717 UTSW Dock10 0.333 R7084 G1 225.01 N 1 80503856 I475F T A missense Het phenotype 05/15/2019
[records 1 to 100 of 440494] next >> last >|