Incidental Mutations

426,400 incidental mutations are currently displayed, and affect 22,218 genes.
65,985 are Possibly Damaging.
155,183 are Probably Damaging.
147,013 are Probably Benign.
44,760 are Probably Null.
17,476 create premature stop codons.
12,049 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 426400] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 550106 UTSW 1500009C09Rik R7089 G1 126.01 N 15 82252573 A T Het 05/15/2019
2 540719 UTSW 1700007K13Rik 0.066 R6819 G1 145.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC Het phenotype 11/16/2018
3 543419 UTSW Abcc12 0.105 R6518 G1 225.01 Y 8 86509089 A G Het phenotype 11/29/2018
4 553365 UTSW Abhd10 0.066 R7141 G1 225.01 N 16 45742806 R29Q C T missense Het phenotype 05/15/2019
5 550342 UTSW Actl6a 1.000 R7094 G1 225.01 N 3 32706338 A T Het phenotype 05/15/2019
6 547457 UTSW Akap11 0.000 R7048 G1 225.01 N 14 78512514 Q811L T A missense Het phenotype 05/13/2019
7 551734 UTSW Amd2 R7115 G1 182.01 N 10 35711637 C A Het 05/15/2019
8 550120 UTSW Ammecr1l 0.281 R7089 G1 225.01 N 18 31761824 A T Het 05/15/2019
9 548908 UTSW Arl2bp 0.168 R7071 G1 223.01 N 8 94667166 G T Het phenotype 05/15/2019
10 553780 UTSW Asl 0.150 R7146 G1 225.01 N 5 130024449 G A Het phenotype 05/15/2019
11 553906 UTSW Atf4 1.000 R7147 G1 217.47 N 15 80257299 AAGCGGGCTGAGC AAGC Het phenotype 05/15/2019
12 554022 UTSW Atf4 1.000 R7149 G1 217.47 N 15 80257299 AAGCGGGCTGAGC AAGC Het phenotype 05/15/2019
13 549888 UTSW BC028528 0.056 R7086 G1 217.47 N 3 95888166 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG Het 05/15/2019
14 549887 UTSW BC028528 0.056 R7086 G1 217.47 N 3 95888137 TCACTGGTTCTGT TCACTGGTTCTGTTGGCACTGGTTCTGT Het 05/15/2019
15 548949 UTSW Btc 0.000 R7072 G1 97.01 N 5 91402937 T C Het phenotype 05/15/2019
16 552420 UTSW Car15 0.050 R7127 G1 225.01 N 16 17838196 T C Het 05/15/2019
17 551134 UTSW Card6 0.000 R7105 G1 214.46 N 15 5098691 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG Het phenotype 05/15/2019
18 552770 UTSW Card6 0.000 R7132 G1 214.46 N 15 5098691 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG Het phenotype 05/15/2019
19 554186 UTSW Casz1 0.428 R7152 G1 225.01 N 4 148901291 C G Het phenotype 05/15/2019
20 531241 UTSW Ccdc171 0.217 PIT4131001 G1 50 Y 4 83661709 C T Het phenotype 08/10/2018
21 549017 UTSW Ccdc24 0.110 R7073 G1 225.01 N 4 117872004 A92D G T missense Het 05/15/2019
22 553644 UTSW Cd209g 0.066 R7144 G1 225.01 N 8 4135189 T G Het 05/15/2019
23 549073 UTSW Cdo1 0.372 R7073 G1 225.01 N 18 46728199 G A Het phenotype 05/15/2019
24 553524 UTSW Cfap57 0.084 R7143 G1 84.01 N 4 118620709 G A Het phenotype 05/15/2019
25 551752 UTSW Chgb 0.076 R7116 G1 225.01 N 2 132781317 A T Het phenotype 05/15/2019
26 540722 UTSW Cmtm1 0.400 R6821 G1 214.46 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
27 540724 UTSW Cmtm1 0.400 R6822 G1 168.47 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
28 551859 UTSW Cntn5 0.000 R7117 G1 225.01 N 9 10904699 T A Het phenotype 05/15/2019
29 545495 UTSW Csmd2 0.315 R7019 G1 225.01 N 4 128369063 D681N G A missense Het 05/13/2019
30 546113 UTSW Csmd2 0.315 R7028 G1 225.01 N 4 128277228 N338S A G missense Het 05/13/2019
31 549834 UTSW Ddx49 0.926 R7085 G1 225.01 N 8 70302483 G A Het 05/15/2019
32 548434 UTSW Decr1 0.320 R7064 G1 225.01 N 4 15945392 C A Het phenotype 05/13/2019
33 551332 UTSW Dpagt1 1.000 R7108 G1 225.01 N 9 44327021 G T Het phenotype 05/15/2019
34 549868 UTSW Drap1 0.321 R7085 G1 121.01 N 19 5424787 G A Het phenotype 05/15/2019
35 549683 UTSW Dusp26 0.283 R7083 G1 148.01 N 8 31091719 A G Het phenotype 05/15/2019
36 549195 UTSW Dusp9 0.050 R7075 G1 214.46 N X 73640611 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG Het phenotype 05/15/2019
37 531244 UTSW Efcab5 0.177 PIT4131001 G1 50 Y 11 77137691 C T Het 08/10/2018
38 535642 UTSW Eml5 0.353 R6375 G1 225.01 Y 12 98798868 T C Het 0.066 09/21/2018
39 533932 UTSW Epha10 0.454 R6813 G1 225.01 Y 4 124902693 S398R T A missense Het 0.061 phenotype 09/12/2018
40 543461 UTSW Espn 0.279 R6551 G1 225.01 Y 4 152128766 T C Het phenotype 01/04/2019
41 532071 UTSW Fam129b 0.610 R6769 G1 143.01 N 2 32895654 C T Het 08/29/2018
42 546703 UTSW Fam71b 0.092 R7036 G1 225.01 N 11 46407408 S513N G A missense Het 05/13/2019
43 552663 UTSW Fbxl12 0.088 R7131 G1 138.01 N 9 20644383 G A Het phenotype 05/15/2019
44 540699 UTSW Fbxo44 0.121 R6498 G1 150.01 Y 4 148154425 C T Het phenotype 11/09/2018
45 539760 UTSW Fkbp2 R6923 G1 225.01 N 19 6979169 A G Het phenotype 11/06/2018
46 548491 UTSW Frmd4a 0.387 R7065 G1 225.01 N 2 4566112 G A Het phenotype 05/13/2019
47 550405 UTSW Fzd1 0.000 R7095 G1 217.47 N 5 4755824 GGGACTCCTCCACCTCCCTGGA GGGA Het phenotype 05/15/2019
48 531250 UTSW Gbp11 0.110 R6336 G1 225.01 Y 5 105325489 A G Het 08/17/2018
49 18413 UTSW Gm10573 R0058 G1 Y 4 121920736 G A Het 03/25/2013
50 102937 APN Gm12588 IGL01655 G1 11 121907951 T A Het 01/21/2014
51 285860 APN Gm12588 IGL02234 11 121908325 T A Het 04/16/2015
52 542405 UTSW Gm12830 0.195 R6975 G1 225.01 N 4 114845049 M136T T C missense Het 11/28/2018
53 292899 APN Gm14178 IGL02426 11 99747515 T C Het 04/16/2015
54 83106 UTSW Gm14178 R0924 G1 225 Y 11 99747500 T18S T A missense Het 11/08/2013
55 296237 APN Gm14179 IGL02504 11 99743177 A T Het 04/16/2015
56 297832 APN Gm14179 IGL02546 11 99743193 A T Het 04/16/2015
57 546149 UTSW Gm17079 R7028 G1 182.01 N 14 51693037 H117R T C missense Het 05/13/2019
58 547800 UTSW Gm17654 0.315 R7054 G1 133.01 N 14 43575870 N188Y T A missense Het 05/13/2019
59 17067 UTSW Gm19618 R0066 G1 Y 6 87714245 A T Het 01/20/2013
60 16283 UTSW Gm19685 R0060 G1 Y 17 60768423 T C Het 01/20/2013
61 16229 UTSW Gm19993 R0053 G1 Y 1 19835048 A G Het 01/08/2013
62 553848 UTSW Gm21886 0.090 R7146 G1 140.47 N 18 80089482 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA Het 05/15/2019
63 547614 UTSW Gm281 0.088 R7051 G1 225.01 N 14 13828486 V758A A G missense Het 05/13/2019
64 545860 UTSW Gm2832 R7024 G1 166.01 N 14 41279739 M68I G A missense Het 05/13/2019
65 548395 UTSW Gm31371 R7063 G1 225.01 N 8 19903412 C7Y G A missense Het 05/13/2019
66 531238 UTSW Gm32647 R6136 G1 216.01 Y 7 94475732 C T Het 0.056 08/07/2018
67 547801 UTSW Gm3327 0.246 R7054 G1 145.01 N 14 44126275 F112S T C missense Het 05/13/2019
68 540723 UTSW Gm40460 R6822 G1 156.46 N 7 142240713 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG Het 11/16/2018
69 549682 UTSW Gm40460 R7083 G1 180.46 N 7 142240713 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG Het 05/15/2019
70 549959 UTSW Gm40460 R7087 G1 116.53 N 7 142240434 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG Het 05/15/2019
71 531239 UTSW Gm45704 R6144 G1 172.01 Y 8 72784292 T A Het 08/07/2018
72 552363 UTSW Gm4779 R7126 G1 214.46 N X 101794171 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG Het 05/15/2019
73 552365 UTSW Gm4779 R7126 G1 218.44 N X 101794185 GGGGCC GGGGCCCGGGCC Het 05/15/2019
74 545404 UTSW Gm7945 R7017 G1 146.01 N 14 41383653 Y156C T C missense Het 05/13/2019
75 111 UTSW Gm8251 0.194 D3080 Y grasshopper 1 44067335 C A Het 03/11/2010
76 551479 UTSW Gm9573 0.235 R7110 G1 104.47 N 17 35622618 CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT Het 05/15/2019
77 553312 UTSW Gm9573 0.235 R7139 G1 180.47 N 17 35622633 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT Het 05/15/2019
78 292284 APN Gm9631 IGL02411 11 121943652 G A Het 04/16/2015
79 292474 APN Gm9631 IGL02417 11 121943652 G A Het 04/16/2015
80 292569 APN Gm9631 IGL02419 11 121943652 G A Het 04/16/2015
81 292613 APN Gm9631 IGL02420 11 121943652 G A Het 04/16/2015
82 18 UTSW Gm9943 A9681 G3 Y atchoum 17 16014992 T A Het 11/10/2009
83 104514 APN Gm9956 IGL01702 G1 10 56745239 A G start gained Het 01/21/2014
84 98880 UTSW Gm9956 R0513 G1 125 Y 10 56745195 G T start gained Het 01/10/2014
85 546803 UTSW Gna14 0.113 R7037 G1 225.01 N 19 16533764 H59L A T missense Het phenotype 05/13/2019
86 554270 UTSW Gpatch8 0.492 R7153 G1 217.47 N 11 102480188 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC Het phenotype 05/15/2019
87 552280 UTSW Hexdc 0.098 R7125 G1 108.01 N 11 121204670 C T Het 05/15/2019
88 539380 UTSW Hps1 0.192 R6916 G1 120.47 N 19 42766725 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC Het phenotype 11/06/2018
89 552135 UTSW Htr1d 0.000 R7123 G1 224.01 N 4 136442353 C T Het phenotype 05/15/2019
90 547092 UTSW Ifi206 0.225 R7042 G1 225.01 N 1 173481242 P396L G A missense Het 05/13/2019
91 548505 UTSW Ifi44l 0.062 R7065 G1 225.01 N 3 151759792 I107T A G missense Het phenotype 05/13/2019
92 544975 UTSW Ighe 0.064 R7010 G1 225.01 N 12 113273141 T36A T C missense Het 05/13/2019
93 536625 UTSW Ighg2b 0.081 R6880 G1 225.01 Y 12 113307106 I135V T C missense Het 10/18/2018
94 547673 UTSW Ighg2c 0.101 R7052 G1 225.01 N 12 113288723 T70A T C missense Het 05/13/2019
95 554155 UTSW Itm2b 0.520 R7151 G1 225.01 N 14 73368389 C A Het phenotype 05/15/2019
96 552698 UTSW Kmt2d 1.000 R7131 G1 217.47 N 15 98849616 GCTGCTGCT GCTGCTGCTCCTGCTGCT Het phenotype 05/15/2019
97 540725 UTSW Krt9 0.000 R6822 G1 217.47 N 11 100189077 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC Het phenotype 11/16/2018
98 540865 UTSW Lama1 1.000 R6945 G1 225.01 N 17 67813866 T2666A A G missense Het phenotype 11/28/2018
99 542874 UTSW Lama1 1.000 R6984 G1 225.01 N 17 67779112 V1449M G A missense Het phenotype 11/28/2018
100 543171 UTSW Lama1 1.000 R6989 G1 225.01 N 17 67753758 S694P T C missense Het phenotype 11/28/2018
[records 1 to 100 of 426400] next >> last >|