Incidental Mutations

426,400 incidental mutations are currently displayed, and affect 22,218 genes.
65,985 are Possibly Damaging.
155,183 are Probably Damaging.
147,013 are Probably Benign.
44,760 are Probably Null.
17,476 create premature stop codons.
12,049 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 426400] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 550106 UTSW 1500009C09Rik R7089 G1 126.01 N 15 82252573 A T Het 05/15/2019
2 540719 UTSW 1700007K13Rik 0.066 R6819 G1 145.46 N 2 28466110 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC Het phenotype 11/16/2018
3 543419 UTSW Abcc12 0.105 R6518 G1 225.01 Y 8 86509089 A G Het phenotype 11/29/2018
4 550342 UTSW Actl6a 1.000 R7094 G1 225.01 N 3 32706338 A T Het phenotype 05/15/2019
5 551734 UTSW Amd2 R7115 G1 182.01 N 10 35711637 C A Het 05/15/2019
6 550120 UTSW Ammecr1l 0.281 R7089 G1 225.01 N 18 31761824 A T Het 05/15/2019
7 548908 UTSW Arl2bp 0.168 R7071 G1 223.01 N 8 94667166 G T Het phenotype 05/15/2019
8 553780 UTSW Asl 0.150 R7146 G1 225.01 N 5 130024449 G A Het phenotype 05/15/2019
9 553906 UTSW Atf4 1.000 R7147 G1 217.47 N 15 80257299 AAGCGGGCTGAGC AAGC Het phenotype 05/15/2019
10 554022 UTSW Atf4 1.000 R7149 G1 217.47 N 15 80257299 AAGCGGGCTGAGC AAGC Het phenotype 05/15/2019
11 549887 UTSW BC028528 0.056 R7086 G1 217.47 N 3 95888137 TCACTGGTTCTGT TCACTGGTTCTGTTGGCACTGGTTCTGT Het 05/15/2019
12 549888 UTSW BC028528 0.056 R7086 G1 217.47 N 3 95888166 GTCACTGGTTCTGTG GTCACTGGTTCTGTGTTCACTGGTTCTGTG Het 05/15/2019
13 548949 UTSW Btc 0.000 R7072 G1 97.01 N 5 91402937 T C Het phenotype 05/15/2019
14 552420 UTSW Car15 0.050 R7127 G1 225.01 N 16 17838196 T C Het 05/15/2019
15 551134 UTSW Card6 0.000 R7105 G1 214.46 N 15 5098691 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG Het phenotype 05/15/2019
16 552770 UTSW Card6 0.000 R7132 G1 214.46 N 15 5098691 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG Het phenotype 05/15/2019
17 554186 UTSW Casz1 0.428 R7152 G1 225.01 N 4 148901291 C G Het phenotype 05/15/2019
18 531241 UTSW Ccdc171 0.217 PIT4131001 G1 50 Y 4 83661709 C T Het phenotype 08/10/2018
19 553644 UTSW Cd209g 0.066 R7144 G1 225.01 N 8 4135189 T G Het 05/15/2019
20 549073 UTSW Cdo1 0.372 R7073 G1 225.01 N 18 46728199 G A Het phenotype 05/15/2019
21 553524 UTSW Cfap57 0.084 R7143 G1 84.01 N 4 118620709 G A Het phenotype 05/15/2019
22 551752 UTSW Chgb 0.076 R7116 G1 225.01 N 2 132781317 A T Het phenotype 05/15/2019
23 540722 UTSW Cmtm1 0.400 R6821 G1 214.46 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
24 540724 UTSW Cmtm1 0.400 R6822 G1 168.47 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
25 551859 UTSW Cntn5 0.000 R7117 G1 225.01 N 9 10904699 T A Het phenotype 05/15/2019
26 549834 UTSW Ddx49 0.926 R7085 G1 225.01 N 8 70302483 G A Het 05/15/2019
27 548434 UTSW Decr1 0.320 R7064 G1 225.01 N 4 15945392 C A Het phenotype 05/13/2019
28 551332 UTSW Dpagt1 1.000 R7108 G1 225.01 N 9 44327021 G T Het phenotype 05/15/2019
29 549868 UTSW Drap1 0.321 R7085 G1 121.01 N 19 5424787 G A Het phenotype 05/15/2019
30 549683 UTSW Dusp26 0.283 R7083 G1 148.01 N 8 31091719 A G Het phenotype 05/15/2019
31 549195 UTSW Dusp9 0.050 R7075 G1 214.46 N X 73640611 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG Het phenotype 05/15/2019
32 531244 UTSW Efcab5 0.177 PIT4131001 G1 50 Y 11 77137691 C T Het 08/10/2018
33 535642 UTSW Eml5 0.353 R6375 G1 225.01 Y 12 98798868 T C Het 0.066 09/21/2018
34 543461 UTSW Espn 0.279 R6551 G1 225.01 Y 4 152128766 T C Het phenotype 01/04/2019
35 532071 UTSW Fam129b 0.610 R6769 G1 143.01 N 2 32895654 C T Het 08/29/2018
36 552663 UTSW Fbxl12 0.088 R7131 G1 138.01 N 9 20644383 G A Het phenotype 05/15/2019
37 540699 UTSW Fbxo44 0.121 R6498 G1 150.01 Y 4 148154425 C T Het phenotype 11/09/2018
38 539760 UTSW Fkbp2 R6923 G1 225.01 N 19 6979169 A G Het phenotype 11/06/2018
39 548491 UTSW Frmd4a 0.387 R7065 G1 225.01 N 2 4566112 G A Het phenotype 05/13/2019
40 550405 UTSW Fzd1 0.000 R7095 G1 217.47 N 5 4755824 GGGACTCCTCCACCTCCCTGGA GGGA Het phenotype 05/15/2019
41 531250 UTSW Gbp11 0.110 R6336 G1 225.01 Y 5 105325489 A G Het 08/17/2018
42 18413 UTSW Gm10573 R0058 G1 Y 4 121920736 G A Het 03/25/2013
43 102937 APN Gm12588 IGL01655 G1 11 121907951 T A Het 01/21/2014
44 285860 APN Gm12588 IGL02234 11 121908325 T A Het 04/16/2015
45 292899 APN Gm14178 IGL02426 11 99747515 T C Het 04/16/2015
46 296237 APN Gm14179 IGL02504 11 99743177 A T Het 04/16/2015
47 297832 APN Gm14179 IGL02546 11 99743193 A T Het 04/16/2015
48 17067 UTSW Gm19618 R0066 G1 Y 6 87714245 A T Het 01/20/2013
49 16283 UTSW Gm19685 R0060 G1 Y 17 60768423 T C Het 01/20/2013
50 16229 UTSW Gm19993 R0053 G1 Y 1 19835048 A G Het 01/08/2013
51 553848 UTSW Gm21886 0.089 R7146 G1 140.47 N 18 80089482 GGGCCTGCAGACAGTAGGTGCTCACTAGGGCCTGTAAATAGTAGGTGCTCACTGAGGCCTGTAGACAGTAGGTGCTCA GGGCCTGTAGACAGTAGGTGCTCA Het 05/15/2019
52 531238 UTSW Gm32647 R6136 G1 216.01 Y 7 94475732 C T Het 0.056 08/07/2018
53 540723 UTSW Gm40460 R6822 G1 156.46 N 7 142240713 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG Het 11/16/2018
54 549682 UTSW Gm40460 R7083 G1 180.46 N 7 142240713 ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG Het 05/15/2019
55 549959 UTSW Gm40460 R7087 G1 116.53 N 7 142240434 GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG GCAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAGCAGGGCTTACAGCAGCTGGACTGGCAGCAG Het 05/15/2019
56 531239 UTSW Gm45704 R6144 G1 172.01 Y 8 72784292 T A Het 08/07/2018
57 552363 UTSW Gm4779 R7126 G1 214.46 N X 101794171 TCGGGGCCGGGGCCGGGGCCG TCGGGGCCGGGGCCGGGGCCGGGGCCG Het 05/15/2019
58 552365 UTSW Gm4779 R7126 G1 218.44 N X 101794185 GGGGCC GGGGCCCGGGCC Het 05/15/2019
59 111 UTSW Gm8251 0.194 D3080 Y grasshopper 1 44067335 C A Het 03/11/2010
60 551479 UTSW Gm9573 0.235 R7110 G1 104.47 N 17 35622618 CGGGGTGGGTGTAGATCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT CGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGATGCAGGGGTGGTCGGGGTAGGTGTAGATCCTGAGGCAGTGCT Het 05/15/2019
61 553312 UTSW Gm9573 0.235 R7139 G1 180.47 N 17 35622633 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT Het 05/15/2019
62 292284 APN Gm9631 IGL02411 11 121943652 G A Het 04/16/2015
63 292474 APN Gm9631 IGL02417 11 121943652 G A Het 04/16/2015
64 292569 APN Gm9631 IGL02419 11 121943652 G A Het 04/16/2015
65 292613 APN Gm9631 IGL02420 11 121943652 G A Het 04/16/2015
66 18 UTSW Gm9943 A9681 G3 Y atchoum 17 16014992 T A Het 11/10/2009
67 554270 UTSW Gpatch8 0.492 R7153 G1 217.47 N 11 102480188 TTCCTCCTCCTCCTCTTCCTCCTCCTC TTCCTCCTCCTCCTCCTCTTCCTCCTCCTC Het phenotype 05/15/2019
68 552280 UTSW Hexdc 0.098 R7125 G1 108.01 N 11 121204670 C T Het 05/15/2019
69 539380 UTSW Hps1 0.192 R6916 G1 120.47 N 19 42766725 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC Het phenotype 11/06/2018
70 552135 UTSW Htr1d 0.000 R7123 G1 224.01 N 4 136442353 C T Het phenotype 05/15/2019
71 554155 UTSW Itm2b 0.520 R7151 G1 225.01 N 14 73368389 C A Het phenotype 05/15/2019
72 552698 UTSW Kmt2d 1.000 R7131 G1 217.47 N 15 98849616 GCTGCTGCT GCTGCTGCTCCTGCTGCT Het phenotype 05/15/2019
73 540725 UTSW Krt9 0.000 R6822 G1 217.47 N 11 100189077 TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC TCCACTTCCTCCTCCATAGCTGCCCCCACTTCCTCCTCCATAGCTGCC Het phenotype 11/16/2018
74 535653 UTSW Lgals4 0.140 R6431 G1 225.01 Y 7 28840692 G T Het phenotype 09/27/2018
75 540707 UTSW Maml3 0.000 R6883 G1 109.47 N 3 51697579 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC Het phenotype 11/16/2018
76 535566 UTSW Mbd1 0.000 R6861 G1 217.47 N 18 74273574 GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC Het phenotype 09/12/2018
77 551027 UTSW Mgea5 1.000 R7103 G1 159.01 N 19 45783166 G A Het phenotype 05/15/2019
78 551469 UTSW Mrpl57 0.107 R7110 G1 225.01 N 14 57826297 G A Het phenotype 05/15/2019
79 549684 UTSW Naf1 0.896 R7083 G1 213.47 N 8 66860486 GCCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA GCCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGA Het phenotype 05/15/2019
80 550369 UTSW Nefh 0.295 R7094 G1 148.47 N 11 4940197 CGCCTCAGCTGGGGGCTTGATATCTTCCTTCACGGGGGACTTGGCCTTCTCAGGAGACTTGGCCTCAGCTGG CGCCTCAGCTGG Het phenotype 05/15/2019
81 552067 UTSW Nfu1 0.530 R7122 G1 225.01 N 6 87009881 A T Het phenotype 05/15/2019
82 553439 UTSW Nrxn1 0.000 R7140 G1 125.01 N 17 91088764 G A Het phenotype 05/15/2019
83 538078 UTSW Nsmce4a 0.837 R6451 G1 225.01 Y 7 130542749 G T Het 0.077 11/01/2018
84 551497 UTSW Ogfr 0.433 R7111 G1 214.46 N 2 180595266 GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG Het phenotype 05/15/2019
85 549573 UTSW Olfr1411 0.075 R7082 G1 110.01 N 1 92596418 G A Het phenotype 05/15/2019
86 552912 UTSW Olfr303 0.044 R7134 G1 225.01 N 7 86395544 G A Het phenotype 05/15/2019
87 550359 UTSW Olfr374 0.075 R7094 G1 160.01 N 8 72109503 A T Het phenotype 05/15/2019
88 553875 UTSW Olfr652 0.073 R7147 G1 215.01 N 7 104564066 A G Het phenotype 05/15/2019
89 551811 UTSW Pam 1.000 R7117 G1 225.01 N 1 97977116 C A Het phenotype 05/15/2019
90 553898 UTSW Papola 0.717 R7147 G1 225.01 N 12 105808638 A T Het phenotype 05/15/2019
91 551867 UTSW Papolg 0.892 R7117 G1 133.01 N 11 23895207 T C Het phenotype 05/15/2019
92 552924 UTSW Pbld2 0.000 R7134 G1 225.01 N 10 63024589 A T Het 05/15/2019
93 551844 UTSW Peg3 0.000 R7117 G1 143.53 N 7 6709168 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC Het phenotype 05/15/2019
94 543456 UTSW Phc1 1.000 R6491 G1 225.01 Y 6 122334964 A G Het 0.094 phenotype 01/04/2019
95 540712 UTSW Ptprb 1.000 R6817 G1 125.46 N 10 116283677 GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT Het phenotype 11/16/2018
96 552533 UTSW Ptprb 1.000 R7129 G1 195.46 N 10 116283677 GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT Het phenotype 05/15/2019
97 551287 UTSW Rin1 0.000 R7107 G1 225.01 N 19 5050773 A G Het phenotype 05/15/2019
98 553964 UTSW Rpl27 0.929 R7148 G1 196.01 N 11 101442406 A G Het phenotype 05/15/2019
99 550780 UTSW Serpina3g 0.045 R7100 G1 225.01 N 12 104238311 T C Het phenotype 05/15/2019
100 538073 UTSW Sez6 0.144 R6475 G1 225.01 Y 11 77973844 A G Het phenotype 10/26/2018
[records 1 to 100 of 426400] next >> last >|