Incidental Mutations

440,494 incidental mutations are currently displayed, and affect 22,269 genes.
69,165 are Possibly Damaging.
161,869 are Probably Damaging.
153,573 are Probably Benign.
46,375 are Probably Null.
18,140 create premature stop codons.
12,461 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
[records 1 to 100 of 440494] next >> last >| per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
1 543419 UTSW Abcc12 0.105 R6518 G1 225.01 Y 8 86509089 A G Het phenotype 11/29/2018
2 559285 UTSW Arid1a 1.000 R7186 G1 107.47 N 4 133753233 TGCCGCCGCCGCCGCCGCCGCCG TGCCGCCGCCGCCGCCGCCG Het phenotype 06/26/2019
3 565277 UTSW Atp9a 0.504 R7271 G1 225.01 N 2 168734127 G A Het 06/26/2019
4 531241 UTSW Ccdc171 0.217 PIT4131001 G1 50 Y 4 83661709 C T Het phenotype 08/10/2018
5 540722 UTSW Cmtm1 0.400 R6821 G1 214.46 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
6 540724 UTSW Cmtm1 0.400 R6822 G1 168.47 N 8 104309702 TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG Het 11/16/2018
7 548434 UTSW Decr1 0.320 R7064 G1 225.01 N 4 15945392 C A Het phenotype 05/13/2019
8 531244 UTSW Efcab5 0.177 PIT4131001 G1 50 Y 11 77137691 C T Het 08/10/2018
9 535642 UTSW Eml5 0.353 R6375 G1 225.01 Y 12 98798868 T C Het 0.066 09/21/2018
10 543461 UTSW Espn 0.279 R6551 G1 225.01 Y 4 152128766 T C Het phenotype 01/04/2019
11 532071 UTSW Fam129b 0.610 R6769 G1 143.01 N 2 32895654 C T Het 08/29/2018
12 540699 UTSW Fbxo44 0.121 R6498 G1 150.01 Y 4 148154425 C T Het phenotype 11/09/2018
13 539760 UTSW Fkbp2 R6923 G1 225.01 N 19 6979169 A G Het phenotype 11/06/2018
14 548491 UTSW Frmd4a 0.387 R7065 G1 225.01 N 2 4566112 G A Het phenotype 05/13/2019
15 531250 UTSW Gbp11 0.093 R6336 G1 225.01 Y 5 105325489 A G Het 08/17/2018
16 18413 UTSW Gm10573 R0058 G1 Y 4 121920736 G A Het 03/25/2013
17 102937 APN Gm12588 IGL01655 G1 11 121907951 T A Het 01/21/2014
18 285860 APN Gm12588 IGL02234 11 121908325 T A Het 04/16/2015
19 292899 APN Gm14178 IGL02426 11 99747515 T C Het 04/16/2015
20 296237 APN Gm14179 IGL02504 11 99743177 A T Het 04/16/2015
21 297832 APN Gm14179 IGL02546 11 99743193 A T Het 04/16/2015
22 17067 UTSW Gm19618 R0066 G1 Y 6 87714245 A T Het 01/20/2013
23 16283 UTSW Gm19685 R0060 G1 Y 17 60768423 T C Het 01/20/2013
24 16229 UTSW Gm19993 R0053 G1 Y 1 19835048 A G Het 01/08/2013
25 531238 UTSW Gm32647 R6136 G1 216.01 Y 7 94475732 C T Het 0.056 08/07/2018
26 531239 UTSW Gm45704 R6144 G1 172.01 Y 8 72784292 T A Het 08/07/2018
27 111 UTSW Gm8251 0.179 D3080 Y grasshopper 1 44067335 C A Het 03/11/2010
28 292284 APN Gm9631 IGL02411 11 121943652 G A Het 04/16/2015
29 292474 APN Gm9631 IGL02417 11 121943652 G A Het 04/16/2015
30 292569 APN Gm9631 IGL02419 11 121943652 G A Het 04/16/2015
31 292613 APN Gm9631 IGL02420 11 121943652 G A Het 04/16/2015
32 18 UTSW Gm9943 A9681 G3 Y atchoum 17 16014992 T A Het 11/10/2009
33 539380 UTSW Hps1 0.192 R6916 G1 120.47 N 19 42766725 ATCCTCCTCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC Het phenotype 11/06/2018
34 535653 UTSW Lgals4 0.140 R6431 G1 225.01 Y 7 28840692 G T Het phenotype 09/27/2018
35 540707 UTSW Maml3 0.000 R6885 G1 109.47 N 3 51697579 TCTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC TCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGC Het phenotype 11/16/2018
36 535566 UTSW Mbd1 0.000 R6861 G1 217.47 N 18 74273574 GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC GTCTGCATCTGCGTCTTCGTCTGCATCTGCATCTGC Het phenotype 09/12/2018
37 538078 UTSW Nsmce4a 0.837 R6451 G1 225.01 Y 7 130542749 G T Het 0.077 11/01/2018
38 543456 UTSW Phc1 1.000 R6491 G1 225.01 Y 6 122334964 A G Het 0.094 phenotype 01/04/2019
39 538073 UTSW Sez6 0.144 R6475 G1 225.01 Y 11 77973844 A G Het phenotype 10/26/2018
40 544766 UTSW Slc7a1 1.000 R7007 G1 225.01 N 5 148352446 G A Het phenotype 05/13/2019
41 531220 UTSW Son 0.950 R6371 G1 225.01 Y 16 91674741 T C Het phenotype 08/06/2018
42 540715 UTSW Was 0.207 R6818 G1 117.47 N X 8086211 GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC Het phenotype 11/16/2018
43 533159 UTSW Wdr26 0.625 R6334 G1 225.01 Y 1 181203206 T C Het phenotype 09/04/2018
44 192678 UTSW 1110017D15Rik 0.069 R1760 G1 225 Y 4 41507330 T A critical splice acceptor site Het probably null 0.542 phenotype 05/23/2014
45 192500 UTSW 1700001C02Rik 0.243 R1699 G1 225 N 5 30483866 A G critical splice acceptor site Het probably null 05/14/2014
46 538049 UTSW 1700011H14Rik 0.029 R6841 G1 225.01 Y 14 49243813 T C critical splice acceptor site Het probably null 10/18/2018
47 388197 UTSW 1700017D01Rik 0.061 R5099 G1 225 Y 19 11112461 T C critical splice acceptor site Het probably null 0.650 06/06/2016
48 478683 UTSW 1700019A02Rik 0.142 R6018 G1 225.01 N 1 53163246 C T critical splice acceptor site Het probably null 06/26/2017
49 190952 UTSW 1700023F06Rik 0.034 R1715 G1 169 N 11 103199824 T C critical splice acceptor site Het probably null 05/14/2014
50 409841 APN 1700029H14Rik 0.025 IGL03069 8 13557704 T G critical splice acceptor site Het probably null 08/02/2016
51 39342 UTSW 1700067P10Rik 0.016 R0445 G1 136 Y 17 48090022 A C critical splice acceptor site Het probably null 0.600 05/23/2013
52 379571 UTSW 2010111I01Rik 0.188 R4911 G1 225 Y 13 63170939 A T critical splice acceptor site Het probably null 0.492 phenotype 04/15/2016
53 26543 UTSW 2010315B03Rik 0.088 P4748 222 N 712 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
54 60600 UTSW 2010315B03Rik 0.088 R0090 G1 213 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
55 60571 UTSW 2010315B03Rik 0.088 R0122 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 07/24/2013
56 22264 UTSW 2010315B03Rik 0.088 R0140 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/16/2013
57 500098 UTSW 2010315B03Rik 0.088 R0164 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 12/01/2017
58 31421 UTSW 2010315B03Rik 0.088 R0388 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 04/24/2013
59 76984 UTSW 2010315B03Rik 0.088 R0775 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
60 76493 UTSW 2010315B03Rik 0.088 R0798 G1 222 N 9 124295159 T C critical splice acceptor site Het probably benign 10/16/2013
61 89620 APN 2300002M23Rik 0.135 IGL01527 G1 17 35567833 G T critical splice acceptor site Het probably null phenotype 12/03/2013
62 406142 UTSW 2310022A10Rik 0.159 R4806 G1 225 Y 7 27565645 A G critical splice acceptor site Het probably null 0.486 07/28/2016
63 559734 UTSW 2700049A03Rik 1.000 R7193 G1 225.01 N 12 71219189 A G critical splice acceptor site Het probably null phenotype 06/26/2019
64 180063 APN 2700062C07Rik 0.754 IGL01919 G1 18 24475523 A G critical splice acceptor site Het probably null 05/07/2014
65 208042 UTSW 4430402I18Rik 0.108 R1850 G1 225 Y 19 28939171 T C critical splice acceptor site Het probably null 0.486 06/23/2014
66 462735 UTSW 4833423E24Rik 0.063 R5765 G1 225 Y 2 85484194 T G critical splice acceptor site Het probably null 0.644 03/01/2017
67 278029 APN 4921507P07Rik 0.117 IGL00852 G1 6 50589184 T A critical splice acceptor site Het probably null 04/16/2015
68 382658 UTSW 4921507P07Rik 0.117 R4976 G1 225 N 6 50589184 T A critical splice acceptor site Het probably null 04/27/2016
69 318775 UTSW 4921524L21Rik 0.103 R4201 G1 225 N 18 6623952 A G critical splice acceptor site Het probably null 06/10/2015
70 370200 UTSW 4930430A15Rik 0.040 R4821 G1 225 Y 2 111204145 T C critical splice acceptor site Het probably null 0.476 02/04/2016
71 507928 UTSW 4930452B06Rik 0.097 R6280 G1 225.01 Y 14 8473414 T G critical splice acceptor site Het probably null 0.550 03/15/2018
72 434933 UTSW 4930467E23Rik R5538 G1 225 N 8 19749414 A C critical splice acceptor site Het probably null 10/24/2016
73 482208 UTSW 4930579C12Rik 0.131 R5454 G1 225 Y 9 89168988 T C critical splice acceptor site Het noncoding transcript 07/11/2017
74 511096 UTSW 4932438A13Rik 0.882 FR4340 217.47 N 3 37050752 TATTATTAT TATTATTATTATTATCATTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
75 511596 UTSW 4932438A13Rik 0.882 FR4737 217.47 N 3 37050754 TTATTAT TTATTATTATTATTACTATTAT critical splice acceptor site Het probably benign phenotype 04/05/2018
76 53494 APN 4932438A13Rik 0.882 IGL01019 G1 3 37006984 G T critical splice acceptor site Het probably null phenotype 06/28/2013
77 212811 UTSW 4932438A13Rik 0.882 R1919 G1 225 N 3 37006983 A G critical splice acceptor site Het probably null phenotype 07/14/2014
78 532627 UTSW 4932438A13Rik 0.882 R6792 G1 225.01 Y 3 37011566 A G critical splice acceptor site Het probably null phenotype 08/29/2018
79 57694 UTSW 5430403G16Rik 0.117 R0628 G1 208 Y 5 109678576 T C critical splice acceptor site Het probably null 0.520 07/11/2013
80 241496 UTSW 5430419D17Rik 0.039 R2221 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
81 241616 UTSW 5430419D17Rik 0.039 R2223 G1 225 Y 7 131247457 A T critical splice acceptor site Het probably null 0.612 10/15/2014
82 249756 UTSW 5830473C10Rik 0.313 R2440 G1 225 N 5 90572689 A G critical splice acceptor site Het probably null 11/12/2014
83 376254 UTSW 9930111J21Rik1 0.130 R4867 G1 225 N 11 48948548 T A critical splice acceptor site Het probably null 03/17/2016
84 420239 APN A2m 0.000 IGL03369 6 121676903 G A critical splice acceptor site Het probably null phenotype 08/02/2016
85 436215 UTSW A2ml1 0.234 R5532 G1 225 N 6 128553330 T A critical splice acceptor site Het probably null 10/24/2016
86 166432 UTSW A430105I19Rik 0.066 R1529 G1 225 N 2 118761760 T A critical splice acceptor site Het probably null 04/13/2014
87 565276 UTSW A430105I19Rik 0.066 R7271 G1 225.01 N 2 118760683 T A critical splice acceptor site Het probably null 06/26/2019
88 391994 UTSW A530016L24Rik 0.017 IGL02835 G1 153 Y 12 112494986 A C critical splice acceptor site Het probably null 0.644 06/08/2016
89 564038 UTSW A730017C20Rik 0.069 R7252 G1 225.01 N 18 59066908 A G critical splice acceptor site Het probably null 06/26/2019
90 345326 UTSW A830018L16Rik 0.155 R4598 G1 225 N 1 11747964 G A critical splice acceptor site Het probably null phenotype 09/25/2015
91 479514 UTSW A830018L16Rik 0.155 R6007 G1 225.01 Y 1 11511916 A G critical splice acceptor site Het probably null 0.522 phenotype 06/26/2017
92 302040 APN Aadacl4 0.098 IGL02648 4 144617822 A T critical splice acceptor site Het probably null 04/16/2015
93 102103 UTSW Aak1 0.221 R1141 G1 149 N 6 86965476 G A critical splice acceptor site Het probably null phenotype 01/15/2014
94 479868 UTSW Aanat 0.051 R6013 G1 225.01 Y 11 116596124 A T critical splice acceptor site Het probably null 0.458 phenotype 06/26/2017
95 204589 UTSW Aass 0.325 R1818 G1 225 N 6 23075858 T A critical splice acceptor site Het probably null phenotype 06/23/2014
96 12430 APN Abca12 1.000 IGL00813 G1 1 71353762 C A critical splice acceptor site Het probably null phenotype 12/06/2012
97 489401 UTSW Abca13 0.145 R6153 G1 225.01 Y 11 9301259 G T critical splice acceptor site Het probably null 0.480 phenotype 10/10/2017
98 4474 APN Abca5 0.201 IGL00487 G1 11 110309450 T A critical splice acceptor site Het probably null phenotype 04/20/2012
99 349067 UTSW Abca6 0.129 R4629 G1 225 N 11 110230549 T C critical splice acceptor site Het probably null phenotype 10/08/2015
100 217018 UTSW Abca8a 0.100 R1962 G1 222 N 11 110026905 T C critical splice acceptor site Het probably null 08/01/2014
[records 1 to 100 of 440494] next >> last >|