Incidental Mutations

452,618 incidental mutations are currently displayed, and affect 22,306 genes.
71,215 are Possibly Damaging.
165,818 are Probably Damaging.
157,599 are Probably Benign.
47,773 are Probably Null.
18,678 create premature stop codons.
12,815 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
|< first << previous [records 440401 to 440449 of 440449] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
440401 36564 UTSW Zcchc11 0.000 R0410 G1 225 N 4 108486555 R255G A G missense Het probably benign 0.267 phenotype 05/09/2013
440402 62902 UTSW Zcchc11 0.000 R0698 G1 133 N 4 108555533 M1477K T A missense Het probably benign 0.225 phenotype 07/30/2013
440403 70910 UTSW Zcchc11 0.000 R0745 G1 225 Y 4 108502955 C G splice site Het probably benign phenotype 09/30/2013
440404 85818 UTSW Zcchc11 0.000 R1080 G1 225 N 4 108479499 E140G A G missense Het possibly damaging 0.816 phenotype 11/18/2013
440405 196903 UTSW Zcchc11 0.000 R1774 G1 225 N 4 108507955 F542L T C missense Het probably damaging 0.998 phenotype 05/23/2014
440406 203669 UTSW Zcchc11 0.000 R1809 G1 225 Y 4 108549355 H1373Q T A missense Het probably damaging 1.000 0.346 phenotype 06/23/2014
440407 210510 UTSW Zcchc11 0.000 R1869 G1 225 N 4 108529300 F1122L T A missense Het probably damaging 0.997 phenotype 06/30/2014
440408 211016 UTSW Zcchc11 0.000 R1874 G1 225 Y 4 108550725 V1397D T A missense Het probably damaging 0.998 0.414 phenotype 06/30/2014
440409 218005 UTSW Zcchc11 0.000 R1958 G1 225 Y 4 108555706 S1535C A T missense Het probably damaging 1.000 0.190 phenotype 08/01/2014
440410 221692 UTSW Zcchc11 0.000 R1976 G1 225 Y 4 108479523 L148P T C missense Het probably benign 0.008 0.092 phenotype 08/25/2014
440411 224303 UTSW Zcchc11 0.000 R2034 G1 225 Y 4 108512195 R651W C T missense Het probably damaging 1.000 0.048 phenotype 08/25/2014
440412 235336 UTSW Zcchc11 0.000 R2164 G1 225 N 4 108503029 R481Q G A missense Het possibly damaging 0.729 phenotype 10/01/2014
440413 241662 UTSW Zcchc11 0.000 R2251 G1 225 N 4 108520208 D938E T A missense Het probably damaging 0.996 phenotype 10/16/2014
440414 257316 UTSW Zcchc11 0.000 R3001 G1 225 Y 4 108512928 E714K G A missense Het probably damaging 0.998 0.282 phenotype 01/11/2015
440415 257272 UTSW Zcchc11 0.000 R3002 G1 225 Y 4 108512928 E714K G A missense Het probably damaging 0.998 0.282 phenotype 01/11/2015
440416 257360 UTSW Zcchc11 0.000 R3003 G1 225 N 4 108512928 E714K G A missense Het probably damaging 0.998 0.282 phenotype 01/11/2015
440417 320734 UTSW Zcchc11 0.000 R4170 G1 225 N 4 108548059 Y1293C A G missense Het probably damaging 1.000 phenotype 06/12/2015
440418 352010 UTSW Zcchc11 0.000 R4667 G1 225 N 4 108495159 E357K G A missense Het probably damaging 0.998 phenotype 10/08/2015
440419 376305 UTSW Zcchc11 0.000 R4868 G1 225 Y 4 108549220 T C splice site Het probably benign phenotype 03/17/2016
440420 386019 UTSW Zcchc11 0.000 R4989 G1 225 Y 4 108526845 T A unclassified Het probably benign phenotype 05/10/2016
440421 385419 UTSW Zcchc11 0.000 R5014 G1 225 Y 4 108526846 T C unclassified Het probably benign 0.067 phenotype 05/10/2016
440422 453534 UTSW Zcchc11 0.000 R5118 G1 225 Y 4 108520292 D966E T A missense Het possibly damaging 0.920 0.086 phenotype 02/09/2017
440423 428039 UTSW Zcchc11 0.000 R5431 G1 225 N 4 108491412 I297N T A missense Het probably damaging 0.999 phenotype 09/01/2016
440424 441046 UTSW Zcchc11 0.000 R5645 G1 225 N 4 108557373 R49H G A missense Het probably damaging 0.999 phenotype 11/08/2016
440425 444079 UTSW Zcchc11 0.000 R5661 G1 225 Y 4 108513187 D761G A G missense Het probably benign 0.055 0.071 phenotype 11/09/2016
440426 455586 UTSW Zcchc11 0.000 R5877 G1 225 Y 4 108512923 V673A T C missense Het probably damaging 0.990 0.118 phenotype 02/10/2017
440427 509454 UTSW Zcchc11 0.000 R6307 G1 225.01 N 4 108555620 I1506N T A missense Het probably damaging 0.999 phenotype 04/02/2018
440428 510395 UTSW Zcchc11 0.000 R6326 G1 225.01 N 4 108478980 T6I C T missense Het probably benign 0.020 phenotype 04/02/2018
440429 514485 UTSW Zcchc11 0.000 R6407 G1 225.01 Y 4 108558782 E1648D G T missense Het probably damaging 0.995 phenotype 05/04/2018
440430 522825 UTSW Zcchc11 0.000 R6493 G1 225.01 N 4 108526805 K1053R A G missense Het probably damaging 1.000 phenotype 06/06/2018
440431 526380 UTSW Zcchc11 0.000 R6587 G1 225.01 N 4 108479449 N123K C A missense Het probably benign 0.000 phenotype 06/25/2018
440432 561372 UTSW Zcchc11 0.000 R7215 G1 225.01 Y 4 108527008 Y1091H T C missense Het probably damaging 0.999 phenotype 06/26/2019
440433 575209 UTSW Zcchc11 0.000 R7413 G1 225.01 N 4 108549336 I1367T T C missense Het possibly damaging 0.687 phenotype 10/07/2019
440434 242527 UTSW Zcchc12 R2271 G1 222 N X 36198465 T345M C T missense Het possibly damaging 0.871 phenotype 10/16/2014
440435 73984 APN Zcchc13 IGL01319 G1 X 103631000 Q110K C A missense Het possibly damaging 0.901 10/07/2013
440436 184502 APN Zcchc14 0.000 IGL02035 G1 8 121604615 T C unclassified Het probably benign 05/07/2014
440437 185364 APN Zcchc14 0.000 IGL02060 G1 8 121603895 S910G T C missense Het probably damaging 0.983 05/07/2014
440438 293816 APN Zcchc14 0.000 IGL02455 8 121606270 A G unclassified Het probably benign 04/16/2015
440439 412837 APN Zcchc14 0.000 IGL03196 8 121609138 C T unclassified Het probably benign 08/02/2016
440440 7729 UTSW Zcchc14 0.000 P0033 G1 Y 8 121610159 A C intron Het probably benign 0.114 10/29/2012
440441 42126 UTSW Zcchc14 0.000 R0483 G1 225 Y 8 121628649 T A intron Het probably benign 0.098 05/23/2013
440442 56923 UTSW Zcchc14 0.000 R0639 G1 201 N 8 121605449 R419* G A nonsense Het probably null 07/11/2013
440443 95878 UTSW Zcchc14 0.000 R1013 G1 225 Y 8 121606925 A G unclassified Het probably benign 0.120 01/05/2014
440444 96491 UTSW Zcchc14 0.000 R1129 G1 225 N 8 121608415 A G unclassified Het probably benign 01/05/2014
440445 172180 UTSW Zcchc14 0.000 R1546 G1 165 N 8 121604263 G A intron Het probably benign 04/13/2014
440446 170758 UTSW Zcchc14 0.000 R1563 G1 220 Y 8 121603979 M882V T C missense Het probably benign 0.098 0.050 04/13/2014
440447 203929 UTSW Zcchc14 0.000 R1861 G1 225 Y 8 121609251 A G unclassified Het probably benign 0.054 06/23/2014
440448 238612 UTSW Zcchc14 0.000 R2200 G1 225 N 8 121605428 A T unclassified Het probably benign 10/02/2014
440449 249147 UTSW Zcchc14 0.000 R2419 G1 225 Y 8 121603936 Q896L T A missense Het probably damaging 0.993 0.068 11/12/2014
440450 320427 UTSW Zcchc14 0.000 R4246 G1 217 N 8 121604292 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG small deletion Het probably benign 06/12/2015
440451 320538 UTSW Zcchc14 0.000 R4249 G1 217 N 8 121604292 CTGATGGTGGTGGTGATGGTGGTGG CTGATGGTGGTGG small deletion Het probably benign 06/12/2015
440452 327267 UTSW Zcchc14 0.000 R4424 G1 208 N 8 121651941 G A intron Het probably benign 07/07/2015
440453 377848 UTSW Zcchc14 0.000 R4470 G1 50 Y 8 121651759 C T intron Het probably benign 0.061 04/13/2016
440454 334184 UTSW Zcchc14 0.000 R4520 G1 225 N 8 121609095 A T unclassified Het probably benign 08/18/2015
440455 350032 UTSW Zcchc14 0.000 R4681 G1 221 Y 8 121608600 G T unclassified Het probably benign 0.076 10/08/2015
440456 399230 UTSW Zcchc14 0.000 R5253 G1 225 Y 8 121618694 T C intron Het probably benign 0.080 07/06/2016
440457 405749 UTSW Zcchc14 0.000 R5314 G1 225 N 8 121608598 G A unclassified Het probably benign 07/22/2016
440458 437529 UTSW Zcchc14 0.000 R5591 G1 225 Y 8 121605448 C T unclassified Het probably benign 0.054 10/26/2016
440459 445789 UTSW Zcchc14 0.000 R5746 G1 211 N 8 121604639 T C unclassified Het probably benign 0.080 11/21/2016
440460 447736 UTSW Zcchc14 0.000 R5781 G1 224 N 8 121604593 A T unclassified Het probably benign 12/15/2016
440461 457593 UTSW Zcchc14 0.000 R5897 G1 131 N 8 121605160 T C unclassified Het probably benign 02/15/2017
440462 460181 UTSW Zcchc14 0.000 R5930 G1 225 Y 8 121611358 A T intron Het probably benign 0.090 02/28/2017
440463 471883 UTSW Zcchc14 0.000 R5963 G1 225 Y 8 121628623 A T intron Het probably benign 0.126 03/31/2017
440464 513421 UTSW Zcchc14 0.000 R6364 G1 192.01 Y 8 121604859 G T unclassified Het probably benign 0.098 04/27/2018
440465 522469 UTSW Zcchc14 0.000 R6562 G1 225.01 Y 8 121604103 N840K A T missense Het probably damaging 0.993 06/06/2018
440466 523926 UTSW Zcchc14 0.000 R6579 G1 180.01 Y 8 121604467 T C intron Het probably benign 06/22/2018
440467 524646 UTSW Zcchc14 0.000 R6592 G1 99.01 Y 8 121604639 T C unclassified Het probably benign 0.080 06/22/2018
440468 528690 UTSW Zcchc14 0.000 R6699 G1 191.01 Y 8 121608616 A T unclassified Het probably benign 0.054 07/24/2018
440469 559862 UTSW Zcchc14 0.000 R7195 G1 225.01 N 8 121608461 I307V T C missense Het unknown 06/26/2019
440470 575608 UTSW Zcchc14 0.000 R7420 G1 113.47 N 8 121651791 ACCGCCGCCGCCGCCGCC ACCGCCGCCGCCGCC intron Het probably benign 10/07/2019
440471 88001 APN Zcchc17 0.307 IGL01462 G1 4 130337109 K96E T C missense Het probably benign 0.010 phenotype 11/18/2013
440472 285468 APN Zcchc17 0.307 IGL02086 4 130316647 *242W T C makesense Het probably null phenotype 04/16/2015
440473 287356 APN Zcchc17 0.307 IGL02277 4 130327221 T179M G A missense Het probably benign 0.152 phenotype 04/16/2015
440474 294298 APN Zcchc17 0.307 IGL02395 4 130337127 V90F C A missense Het probably damaging 0.999 phenotype 04/16/2015
440475 292129 APN Zcchc17 0.307 IGL02407 4 130349315 M25T A G missense Het probably benign 0.000 phenotype 04/16/2015
440476 33247 UTSW Zcchc17 0.307 R0105 G1 219 Y 4 130349306 D28V T A missense Het probably benign 0.360 0.202 phenotype 05/09/2013
440477 36153 UTSW Zcchc17 0.307 R0245 G1 182 Y 4 130337154 I81L T A missense Het probably benign 0.000 0.180 phenotype 05/09/2013
440478 94961 UTSW Zcchc17 0.307 R1026 G1 225 N 4 130329610 V128I C T missense Het possibly damaging 0.955 phenotype 01/05/2014
440479 193263 UTSW Zcchc17 0.307 R1764 G1 225 Y 4 130329595 C133G A C missense Het probably damaging 0.969 0.410 phenotype 05/23/2014
440480 235197 UTSW Zcchc17 0.307 R2162 G1 225 Y 4 130338524 D62G T C missense Het probably benign 0.036 0.100 phenotype 10/01/2014
440481 247730 UTSW Zcchc17 0.307 R2389 G1 225 N 4 130327204 K185* T A nonsense Het probably null phenotype 11/11/2014
440482 273986 UTSW Zcchc17 0.307 R3831 G1 225 N 4 130338524 D62G T C missense Het probably benign 0.036 0.100 phenotype 04/02/2015
440483 316674 UTSW Zcchc17 0.307 R4078 G1 225 Y 4 130329625 I123L T G missense Het possibly damaging 0.650 0.284 phenotype 05/15/2015
440484 435215 UTSW Zcchc17 0.307 R5553 G1 225 N 4 130354134 A G critical splice donor site 2 bp Het probably null phenotype 10/24/2016
440485 562615 UTSW Zcchc17 0.307 R7233 G1 225.01 Y 4 130327323 D145V T A missense Het probably damaging 0.980 phenotype 06/26/2019
440486 319987 UTSW Zcchc18 0.072 R4224 G1 222 Y X 136994666 N10I A T missense Het probably damaging 0.988 0.183 06/12/2015
440487 320024 UTSW Zcchc18 0.072 R4225 G1 222 Y X 136994666 N10I A T missense Het probably damaging 0.988 0.183 06/12/2015
440488 7396 APN Zcchc2 0.318 IGL00587 G1 1 106030263 S821R T A missense Het probably benign 0.250 04/20/2012
440489 74775 APN Zcchc2 0.318 IGL01339 G1 1 106029775 S659P T C missense Het probably damaging 0.998 10/07/2013
440490 183501 APN Zcchc2 0.318 IGL01981 G1 1 106027499 E640G A G missense Het probably damaging 0.999 05/07/2014
440491 282918 APN Zcchc2 0.318 IGL02172 1 106000934 D308N G A missense Het probably benign 0.005 04/16/2015
440492 362275 APN Zcchc2 0.318 IGL02864 1 106016084 H460Y C T missense Het probably damaging 0.996 12/18/2015
440493 407024 APN Zcchc2 0.318 IGL02993 1 106030168 F790L T C missense Het probably damaging 0.987 08/02/2016
440494 411521 APN Zcchc2 0.318 IGL03163 1 106031111 V1104A T C missense Het probably damaging 0.995 08/02/2016
440495 7824 UTSW Zcchc2 0.318 P0042 G1 Y 1 106030997 T1066I C T missense Het possibly damaging 0.946 0.280 10/29/2012
440496 23531 UTSW Zcchc2 0.318 R0200 G1 225 N 1 106004123 L352M T A missense Het probably damaging 1.000 04/16/2013
440497 41832 UTSW Zcchc2 0.318 R0477 G1 225 Y 1 106030270 P426S C T missense Het possibly damaging 0.908 0.061 05/23/2013
440498 47075 UTSW Zcchc2 0.318 R0501 G1 113 N 1 106016091 F462C T G missense Het possibly damaging 0.882 06/12/2013
440499 218710 UTSW Zcchc2 0.318 R0689 G1 69 Y 1 106030504 Q504* C T nonsense Het probably null 0.608 08/20/2014
440500 202887 UTSW Zcchc2 0.318 R1799 G1 225 N 1 106030287 S829R T A missense Het probably benign 0.001 06/23/2014
|< first << previous [records 440401 to 440449 of 440449]