Incidental Mutations

440,596 incidental mutations are currently displayed, and affect 22,269 genes.
69,168 are Possibly Damaging.
161,870 are Probably Damaging.
153,576 are Probably Benign.
46,470 are Probably Null.
18,141 create premature stop codons.
12,460 are critical splice junction mutations.

Mutations in Coding Regions/Splice Sites Identified by Next-Gen Sequencing
|< first << previous [records 429101 to 429173 of 429173] per page Full List
 
ID question?
Source question?
Gene question?
E-score question?
 
Stock # question?
Gen question?
Quality
-
Vld question?
Strain question?
Chr question?
Position question?
 
Mutation question?
Ref
Var
Type question?
Exon Dist question?
 
Zygosity question?
Predicted Effect question?
PPH Score question?
-
Meta Score question?
 
MGI Phenotype question?
Posted question?
 
429101 345122 UTSW Zdhhc11 0.000 R4618 G1 225 Y 13 73979230 M242K T A missense Het probably benign 0.349 0.106 09/25/2015
429102 470590 UTSW Zdhhc11 0.000 R5197 G1 225 Y 13 73965569 I77V A G missense Het probably benign 0.014 0.122 03/16/2017
429103 481969 UTSW Zdhhc11 0.000 R5990 G1 225.01 Y 13 73979184 W227R T A missense Het probably benign 0.304 0.100 06/26/2017
429104 563946 UTSW Zdhhc11 0.000 R7251 G1 225.01 N 13 73992097 V336L G T missense Het probably benign 0.000 06/26/2019
429105 288445 APN Zdhhc12 0.262 IGL02325 2 30091436 V205I C T missense Het probably damaging 0.999 04/16/2015
429106 301487 APN Zdhhc12 0.262 IGL02635 2 30093519 I24F T A missense Het probably damaging 0.999 04/16/2015
429107 41038 UTSW Zdhhc12 0.262 R0066 G1 225 Y 2 30092535 R50H C T missense Het probably damaging 0.997 0.022 05/23/2013
429108 230933 UTSW Zdhhc12 0.262 R2106 G1 225 N 2 30091802 C116Y C T missense Het probably damaging 1.000 09/18/2014
429109 343774 UTSW Zdhhc12 0.262 R4583 G1 225 N 2 30091484 F189L A G missense Het probably benign 0.000 09/24/2015
429110 382455 UTSW Zdhhc12 0.262 R4974 G1 225 Y 2 30091526 R175W G A missense Het probably damaging 0.999 0.166 04/27/2016
429111 423065 UTSW Zdhhc12 0.262 R5365 G1 225 N 2 30093509 V27A A G missense Het probably damaging 0.998 08/04/2016
429112 436576 UTSW Zdhhc12 0.262 R5561 G1 184 N 2 30092484 L53Q A T missense Het probably null 1.000 10/24/2016
429113 278012 APN Zdhhc13 1.000 IGL00852 G1 7 48805601 S260R T A missense Het probably benign 0.002 phenotype 04/16/2015
429114 154500 APN Zdhhc13 1.000 IGL01820 G1 7 48808865 S316P T C missense Het probably damaging 0.999 phenotype 02/04/2014
429115 364519 APN Zdhhc13 1.000 IGL02941 7 48817138 G A splice site Het probably benign phenotype 12/18/2015
429116 555407 UTSW Zdhhc13 1.000 PIT4445001 G1 225.01 N 7 48795949 G26S G A missense Het probably benign 0.001 phenotype 06/07/2019
429117 40019 UTSW Zdhhc13 1.000 R0456 G1 225 N 7 48808854 F182S T C missense Het probably benign 0.031 phenotype 05/23/2013
429118 160234 UTSW Zdhhc13 1.000 R1398 G1 217 Y 7 48826873 G579R G A missense Het probably damaging 0.998 0.768 phenotype 03/14/2014
429119 196376 UTSW Zdhhc13 1.000 R1785 G1 225 N 7 48824644 L548Q T A missense Het possibly damaging 0.955 0.766 phenotype 05/23/2014
429120 202810 UTSW Zdhhc13 1.000 R1786 G1 225 Y 7 48824644 L548Q T A missense Het possibly damaging 0.955 0.766 phenotype 06/23/2014
429121 226680 UTSW Zdhhc13 1.000 R2066 G1 225 Y 7 48816427 V284D T A missense Het probably benign 0.037 0.110 phenotype 09/17/2014
429122 228083 UTSW Zdhhc13 1.000 R2131 G1 225 N 7 48824644 L548Q T A missense Het possibly damaging 0.955 0.766 phenotype 09/17/2014
429123 233536 UTSW Zdhhc13 1.000 R2133 G1 225 N 7 48824644 L548Q T A missense Het possibly damaging 0.955 0.766 phenotype 10/01/2014
429124 247956 UTSW Zdhhc13 1.000 R2405 G1 225 N 7 48822730 A G splice site 3 bp Het probably null phenotype 11/11/2014
429125 273211 UTSW Zdhhc13 1.000 R3770 G1 225 N 7 48802944 L5M T A missense Het probably damaging 1.000 phenotype 03/25/2015
429126 325029 UTSW Zdhhc13 1.000 R4374 G1 225 Y 7 48808841 Y308H T C missense Het probably damaging 0.998 0.072 phenotype 07/06/2015
429127 367604 UTSW Zdhhc13 1.000 R4772 G1 225 Y 7 48799873 Y73C A G missense Het probably benign 0.243 0.288 phenotype 12/29/2015
429128 455748 UTSW Zdhhc13 1.000 R5052 G1 223 Y 7 48824731 N577S A G missense Het possibly damaging 0.466 0.664 phenotype 02/13/2017
429129 432715 UTSW Zdhhc13 1.000 R5455 G1 225 N 7 48805575 T122A A G missense Het possibly damaging 0.950 phenotype 10/06/2016
429130 518072 UTSW Zdhhc13 1.000 R6418 G1 225.01 Y 7 48811401 T362A A G missense Het possibly damaging 0.944 0.288 phenotype 05/24/2018
429131 519794 UTSW Zdhhc13 1.000 R6502 G1 216.01 N 7 48815560 E406G A G missense Het possibly damaging 0.953 phenotype 06/06/2018
429132 553069 UTSW Zdhhc13 1.000 R7136 G1 225.01 N 7 48801332 I108V A G missense Het probably benign 0.000 phenotype 05/15/2019
429133 3931 APN Zdhhc14 0.096 IGL00419 G1 17 5752684 T C splice site Het probably benign 04/20/2012
429134 29256 APN Zdhhc14 0.096 IGL00909 G1 17 5752792 H390R A G missense Het probably benign 0.000 04/17/2013
429135 29329 APN Zdhhc14 0.096 IGL00964 G1 17 5712481 L220Q T A missense Het probably damaging 1.000 04/17/2013
429136 79540 APN Zdhhc14 0.096 IGL01398 G1 17 5712463 I214T T C missense Het possibly damaging 0.903 11/05/2013
429137 88694 APN Zdhhc14 0.096 IGL01483 G1 17 5712458 M212I G A missense Het probably benign 0.006 11/18/2013
429138 283598 APN Zdhhc14 0.096 IGL02185 17 5752882 T420K C A missense Het probably benign 0.007 04/16/2015
429139 360223 APN Zdhhc14 0.096 IGL02801 17 5726819 T G splice site Het probably null 12/18/2015
429140 23148 UTSW Zdhhc14 0.096 R0189 G1 225 Y 17 5725264 S264P T C missense Het possibly damaging 0.903 0.150 04/16/2013
429141 37798 UTSW Zdhhc14 0.096 R0304 G1 225 Y 17 5725336 T C splice site Het probably benign 05/23/2013
429142 57379 UTSW Zdhhc14 0.096 R0648 G1 225 Y 17 5493602 N52K C A missense Het probably benign 0.010 0.184 07/11/2013
429143 96504 UTSW Zdhhc14 0.096 R1017 G1 225 Y 17 5493649 L68H T A missense Het probably damaging 0.994 0.138 01/05/2014
429144 175764 UTSW Zdhhc14 0.096 R1595 G1 225 Y 17 5493556 R37L G T missense Het probably benign 0.003 0.204 04/24/2014
429145 249015 UTSW Zdhhc14 0.096 R2416 G1 225 N 17 5753008 R462H G A missense Het probably benign 0.000 11/12/2014
429146 267020 UTSW Zdhhc14 0.096 R3420 G1 225 N 17 5753091 *490R T A makesense Het probably null 0.562 02/18/2015
429147 267065 UTSW Zdhhc14 0.096 R3421 G1 196 Y 17 5753091 *490R T A makesense Het probably null 0.562 02/18/2015
429148 315986 UTSW Zdhhc14 0.096 R4063 G1 225 Y 17 5752708 C362F G T missense Het probably damaging 0.997 0.144 05/15/2015
429149 317488 UTSW Zdhhc14 0.096 R4088 G1 225 Y 17 5726856 K296R A G missense Het probably benign 0.007 0.092 05/15/2015
429150 424256 UTSW Zdhhc14 0.096 R5359 G1 225 N 17 5493546 I34V A G missense Het probably benign 0.000 08/04/2016
429151 504967 UTSW Zdhhc14 0.096 R6236 G1 225.01 Y 17 5493643 L66P T C missense Het probably damaging 0.996 0.420 02/28/2018
429152 546202 UTSW Zdhhc14 0.096 R7029 G1 216.01 N 17 5647911 Y85C A G missense Het probably damaging 0.974 05/13/2019
429153 53339 APN Zdhhc15 0.058 IGL01118 G1 X 104598106 Q82K G T missense Het probably benign 0.003 phenotype 06/21/2013
429154 73100 APN Zdhhc15 0.058 IGL01295 G1 X 104544913 T C splice site Het probably null phenotype 10/07/2013
429155 104649 APN Zdhhc15 0.058 IGL01707 G1 X 104565816 R208C G A missense Het probably damaging 0.993 phenotype 01/21/2014
429156 326776 UTSW Zdhhc15 0.058 R4404 G1 222 N X 104560688 R322* G A nonsense Het probably null 0.614 phenotype 07/07/2015
429157 327743 UTSW Zdhhc15 0.058 R4407 G1 222 Y X 104560688 R322* G A nonsense Het probably null 0.614 phenotype 07/07/2015
429158 511304 UTSW Zdhhc16 0.494 FR4342 86.01 N 19 41942149 G A intron Het probably benign phenotype 04/05/2018
429159 512142 UTSW Zdhhc16 0.494 FR4548 217.47 N 19 41942168 CACA CACAACAGGGAAAGCAGTCTGTCAACA frame shift Het probably null phenotype 04/05/2018
429160 2048 APN Zdhhc16 0.494 IGL00230 G1 19 41939660 F206S T C missense Het probably benign 0.293 phenotype 12/09/2011
429161 72871 APN Zdhhc16 0.494 IGL01290 G1 19 41938048 T A unclassified Het probably null phenotype 10/07/2013
429162 76030 APN Zdhhc16 0.494 IGL01368 G1 19 41941506 T A unclassified Het probably null phenotype 10/07/2013
429163 283878 APN Zdhhc16 0.494 IGL02191 19 41937691 C8* C A nonsense Het probably null phenotype 04/16/2015
429164 555941 UTSW Zdhhc16 0.494 PIT4458001 G1 191.01 N 19 41937770 G55R G A missense Het possibly damaging 0.656 phenotype 06/07/2019
429165 151530 UTSW Zdhhc16 0.494 R1258 G1 225 N 19 41938044 V89M G A missense Het possibly damaging 0.642 phenotype 01/29/2014
429166 156859 UTSW Zdhhc16 0.494 R1335 G1 225 Y 19 41940634 T A intron Het probably null 0.635 phenotype 02/11/2014
429167 195035 UTSW Zdhhc16 0.494 R1757 G1 225 Y 19 41941955 N14S A G missense Het probably damaging 1.000 0.066 phenotype 05/23/2014
429168 275514 UTSW Zdhhc16 0.494 R3833 G1 225 Y 19 41938114 T A critical splice donor site 2 bp Het probably null 0.042 phenotype 04/06/2015
429169 325352 UTSW Zdhhc16 0.494 R4381 G1 224 Y 19 41940654 Y232C A G missense Het possibly damaging 0.632 0.150 phenotype 07/06/2015
429170 345058 UTSW Zdhhc16 0.494 R4615 G1 225 N 19 41943683 V358A T C missense Het possibly damaging 0.735 phenotype 09/25/2015
429171 448242 UTSW Zdhhc16 0.494 R5789 G1 225 Y 19 41938133 H98Q T A missense Het probably damaging 1.000 0.246 phenotype 12/15/2016
429172 487853 UTSW Zdhhc16 0.494 R6177 G1 225.01 Y 19 41937759 Y31C A G missense Het probably benign 0.056 phenotype 10/10/2017
429173 564041 UTSW Zdhhc16 0.494 R7252 G1 225.01 N 19 41941551 W271L G T missense Het probably damaging 1.000 phenotype 06/26/2019
429174 90350 APN Zdhhc17 0.000 IGL01546 G1 10 110946193 V547M C T missense Het probably damaging 0.997 phenotype 12/03/2013
429175 154282 APN Zdhhc17 0.000 IGL01812 G1 10 110948217 H466L T A missense Het possibly damaging 0.931 phenotype 02/04/2014
429176 180988 APN Zdhhc17 0.000 IGL01948 G1 10 110946276 T519K G T missense Het possibly damaging 0.560 phenotype 05/07/2014
429177 183111 APN Zdhhc17 0.000 IGL02002 G1 10 110967689 V256I C T missense Het probably benign 0.000 phenotype 05/07/2014
429178 414957 APN Zdhhc17 0.000 IGL03263 10 110961016 D298G T C missense Het probably damaging 0.995 phenotype 08/02/2016
429179 22849 UTSW Zdhhc17 0.000 R0153 G1 225 Y 10 110955094 Y371* A T nonsense Het probably null 0.634 phenotype 04/16/2013
429180 30700 UTSW Zdhhc17 0.000 R0375 G1 225 Y 10 110982106 Y58* A T nonsense Het probably null 0.614 phenotype 04/24/2013
429181 39017 UTSW Zdhhc17 0.000 R0436 G1 178 Y 10 110981990 A T splice site 6 bp Het probably null 0.618 phenotype 05/23/2013
429182 161083 UTSW Zdhhc17 0.000 R1452 G1 223 Y 10 110955075 F378L A G missense Het probably benign 0.035 0.162 phenotype 03/14/2014
429183 168881 UTSW Zdhhc17 0.000 R1496 G1 225 Y 10 110946210 H541P T G missense Het probably damaging 0.993 0.462 phenotype 04/13/2014
429184 166384 UTSW Zdhhc17 0.000 R1528 G1 225 N 10 110948189 A T critical splice donor site 2 bp Het probably null phenotype 04/13/2014
429185 206142 UTSW Zdhhc17 0.000 R1856 G1 225 N 10 110947293 A G splice site 6 bp Het probably null phenotype 06/23/2014
429186 231305 UTSW Zdhhc17 0.000 R2119 G1 225 N 10 110982048 N90D T C missense Het possibly damaging 0.917 phenotype 09/18/2014
429187 309883 UTSW Zdhhc17 0.000 R3747 G1 225 N 10 110944420 I624M T C missense Het probably benign 0.238 phenotype 04/17/2015
429188 376104 UTSW Zdhhc17 0.000 R4900 G1 225 Y 10 110985958 D60G T C missense Het possibly damaging 0.946 0.324 phenotype 03/17/2016
429189 441230 UTSW Zdhhc17 0.000 R5647 G1 225 Y 10 110973833 I153N A T missense Het probably damaging 0.997 0.264 phenotype 11/08/2016
429190 445150 UTSW Zdhhc17 0.000 R5758 G1 225 N 10 110944395 *633Q A G makesense Het probably null phenotype 11/21/2016
429191 504484 UTSW Zdhhc17 0.000 R6228 G1 225.01 Y 10 110956355 D324G T C missense Het probably benign 0.006 phenotype 02/28/2018
429192 537748 UTSW Zdhhc17 0.000 R6823 G1 225.01 Y 10 110955111 T366A T C missense Het possibly damaging 0.907 phenotype 10/18/2018
429193 558358 UTSW Zdhhc17 0.000 R7172 G1 225.01 N 10 111009948 L28P A G missense Het possibly damaging 0.820 phenotype 06/26/2019
429194 462685 UTSW Zdhhc17 0.000 Z1088 225 N 10 110945466 T C splice site 3 bp Het probably null phenotype 03/01/2017
429195 50895 APN Zdhhc18 0.152 IGL01100 G1 4 133612958 Y293N A T missense Het probably damaging 1.000 06/21/2013
429196 91226 APN Zdhhc18 0.152 IGL01575 G1 4 133613899 V221A A G missense Het probably damaging 0.999 12/09/2013
429197 280693 APN Zdhhc18 0.152 IGL02122 4 133613635 A T splice site Het probably benign 04/16/2015
429198 34181 UTSW Zdhhc18 0.152 R0316 G1 225 N 4 133613655 K265* T A nonsense Het probably null 05/09/2013
429199 160222 UTSW Zdhhc18 0.152 R1398 G1 218 Y 4 133627297 F125L G C missense Het probably benign 0.002 0.094 03/14/2014
429200 193264 UTSW Zdhhc18 0.152 R1764 G1 167 Y 4 133608676 M375L T A missense Het probably benign 0.004 0.106 05/23/2014
|< first << previous [records 429101 to 429173 of 429173]